915
edits
Changes
Filled in details about reverse transcriptase
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM* dNTP Mixture (10 mM of each)
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer
==Protocol==
===Reverse Transcriptase===
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Add to a PCR tube (this is per reaction):
** 1 uL of Oligo dT Primer
** 1uL of dNTP
** 500 ng of RNA
** Sterile water up to 13 uL
* Heat at 65C for 5 minutes
* Briefly centrifugre then add (per reaction):
** 4 uL 5X First Strand Buffer
** 1 uL 0.1M DTT
** 1 uL RNAseOUT
** 1 uL of Superscript III RT
* Mix gently by pipetting and place in the PCR machine for the following program:
** Incubate at 50C for 60 min
** Inactivate by heating at 70C for 15 min
===qPCR===
* 40ng Try 50ng of cDNA was used as a template in each reaction(1/10th of the cDNA mixture).
* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification
