Changes

Jump to: navigation, search

Quantification of miRNA by SYBR Green qPCR

988 bytes added, 20:56, 20 July 2015
copied protocol from Pfeffer paper
[[ Category: miRNA ]]
[[ Category: Molecular Biology ]]
[[ Category: Transcription ]]

This is adapted from Pfeffer ''et al'' 2015

==Materials==
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer

==Protocol==

===Reverse Transcriptase==
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
===qPCR===
* 40ng of cDNA was used as a template in each reaction.
* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.

Navigation menu