Quantification of miRNA by SYBR Green qPCR: Difference between revisions

Line 6:

see [[ SOP - Chloroform ]] for safety information about working with Chloroform.

This is adapted from [http://dx.doi.org Yang ''et al'' 2010]

This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]

==Materials==

* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]

Line 14:

* Isopropanol

* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)

* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM

* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM

* dNTP Mixture (10 mM of each)

* dNTP Mixture (10 mM of each). Note this is not the normal 1 mM dNTP stock in the lab.

* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''

* Mature miRNA Primer

* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.

==Protocol==

Line 32:

* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol

* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins

* ~~Reedissolved~~ in 25 μL of water

* Redissolved in 6 μL of water

===Reverse Transcriptase===

* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer

* Add to ~~a PCR~~ tube (this is per reaction):

* Add to an eppendorf tube (this is per reaction):

** 1 uL of Oligo dT Primer

** 1 uL of miRNA Oligo dT Adapter Primer

** 1uL of dNTP

** 6uL of tailed RNA

** 5 uL Sterile water

* Heat at 65C for 5 minutes

* Heat at 65C for 5 minutes in the heating block.

* Briefly ~~centrifugre~~ then add (per reaction):

* Briefly centrifuge then transfer to a PCR tube and add (per reaction):

** 4 uL 5X First Strand Buffer

** 1 uL 0.1M DTT

** 1 uL RNAseOUT

** 1 uL of Superscript III RT

* Mix gently by pipetting and place in the PCR machine for the following program:

* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):

** Incubate at 50C for 60 min

** Inactivate by heating at 70C for 15 min

* Can store the tailed cDNA at -20 until qPCR

===qPCR===

* ~~Try 50ng~~ of cDNA was as a template in each reaction (1/10th of the cDNA mixture).

* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).

* The reverse primer was from the adapter sequence: 5'~~GCGAGCACAGAATTAATACGACTCAC3~~' and the forward primers were specific to miRNA mature sequences.

* The reverse primer was from the adapter sequence: 5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.

* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.

* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

@@ Line 6: / Line 6: @@
 see [[ SOP - Chloroform ]] for safety information about working with Chloroform.
-This is adapted from [http://dx.doi.org Yang ''et al'' 2010]
+This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]
 ==Materials==
 * Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
@@ Line 14: / Line 14: @@
 * Isopropanol
 * Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
-* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
+* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
-* dNTP Mixture (10 mM of each)
+* dNTP Mixture (10 mM of each).  Note this is not the normal 1 mM dNTP stock in the lab.
 * Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
-* Mature miRNA Primer
+* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.
 ==Protocol==
@@ Line 32: / Line 32: @@
 * Transfer the upper (aqueous) layer to a clean tube.   Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
 * Add 140 uL of isopropanol, mix and incubate 5 minutes.  Centrifuge 15 minutes on max.  Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
-* Reedissolved in 25 μL of water
+* Redissolved in 6 μL of water
 ===Reverse Transcriptase===
 * Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
-* Add to a PCR tube (this is per reaction):
+* Add to an eppendorf tube (this is per reaction):
-** 1 uL of Oligo dT Primer
+** 1 uL of miRNA Oligo dT Adapter Primer
 ** 1uL of dNTP
 ** 6uL of tailed RNA
 ** 5 uL Sterile water
-* Heat at 65C for 5 minutes
+* Heat at 65C for 5 minutes in the heating block.
-* Briefly centrifugre then add (per reaction):
+* Briefly centrifuge then transfer to a PCR tube and add (per reaction):
 ** 4 uL 5X First Strand Buffer
 ** 1 uL 0.1M DTT
 ** 1 uL RNAseOUT
 ** 1 uL of Superscript III RT
-* Mix gently by pipetting and place in the PCR machine for the following program:
+* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):
 ** Incubate at 50C for 60 min
 ** Inactivate by heating at 70C for 15 min
+* Can store the tailed cDNA at -20 until qPCR
 ===qPCR===
-* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
+* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
-* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
+* The reverse primer was from the adapter sequence:  5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.
 * The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
 * Can use a protocol similar to the [[ QPCR ]] for mRNA quantification