Quantification of miRNA by SYBR Green qPCR

From Bridges Lab Protocols
Revision as of 20:56, 20 July 2015 by Davebrid (talk | contribs) (copied protocol from Pfeffer paper)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.


This is adapted from Pfeffer et al 2015

Materials

  • Purify total RNA, via the protocol: Purification of miRNA and mRNA with TRIzol
  • Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
  • Oligo dT Adapter Primer 5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3
  • Reverse Adapter Sequence 5'GCGAGCACAGAATTAATACGACTCAC-3
  • Mature miRNA Primer

Protocol

=Reverse Transcriptase

  • Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer

qPCR

  • 40ng of cDNA was used as a template in each reaction.
  • The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
  • The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
Retrieved from "http://bridgeslab.sph.umich.edu/protocols/index.php?title=Quantification_of_miRNA_by_SYBR_Green_qPCR&oldid=936"