Vinexin Genotyping

Revision as of 15:13, 6 August 2012 by Davebridges (Talk | contribs) (Revised adding sections for Primers and PCR Program)

Revision as of 15:13, 6 August 2012 by Davebridges (Talk | contribs) (Revised adding sections for Primers and PCR Program)

From Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.

Primers

  • F1 AAGCTGAGCGCAGAGCTGGACAAGGACCTG
  • R1 CCTGGAGTCTGCAGTTTCTAAGTCTCTCCC
  • F2 TGCGAACTTTTCCGGAGGAGGTGGTGTCACTGG
  • R2 TCCCTACCTGTCTCTCTCACTCACCTCCAC

PCR Program

  • 94C for 3min
  • 25 Cycles of:
    • 94C for 25s
    • 65C for 25s
    • 72C for 150s


Protocol From Paper

The genotypes of mutant mice were determined by nested PCR and confirmed by Southern blot analysis of genomic DNA from tail biopsies. Briefly, tail samples were incubated in lysis buffer (10 mM Tris (pH8.0), 150 mM NaCl, 10 mM EDTA, 0.1% SDS and 1 mg/ml proteinase K) at 55 °C for 4 h, followed by purification with phenol/chloroform and precipitation with isopropyl alcohol. The first PCR for nest PCR was performed using primers (F1 AAGCTGAGCGCAGAGCTGGACAAGGACCTG, R1 CCTGGAGTCTGCAGTTTCTAAGTCTCTCCC) under the following amplification conditions: 94 °C for 3 min, 25 cycles of 94 °C for 25 s, 65 °C for 25 s, and 72 °C for 150 s. A primer set (F2 TGCGAACTTTTCCGGAGGAGGTGGTGTCACTGG and R2 TCCCTACCTGTCTCTCTCACTCACCTCCAC) was used for the second PCR under the same amplification conditions to detect the wild-type allele (1.5 kb) and targeted allele (2.5 kb). In some experiments, another primer set (F2 and R3 TGGGTGGAAACATTCCAGGCCTGGGTGAGAGG) was used to detect the targeted allele only. For Southern blotting, SalI/EcoRI-digested genomic DNA was probed with a 0.4-kb fragment immediately upstream of the 5′ arm (Supplemental Fig. S1A, S1B).