Quantification of miRNA by SYBR Green qPCR: Difference between revisions
copied protocol from Pfeffer paper |
Filled in details about reverse transcriptase |
||
| Line 8: | Line 8: | ||
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]] | * Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]] | ||
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093) | * Superscript III reverse transcriptase (Life Technologies Catalog # 18080093) | ||
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''' | * Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM | ||
* dNTP Mixture (10 mM of each) | |||
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3''' | * Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3''' | ||
* Mature miRNA Primer | * Mature miRNA Primer | ||
| Line 14: | Line 15: | ||
==Protocol== | ==Protocol== | ||
===Reverse Transcriptase== | ===Reverse Transcriptase=== | ||
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer | * Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer | ||
* Add to a PCR tube (this is per reaction): | |||
** 1 uL of Oligo dT Primer | |||
** 1uL of dNTP | |||
** 500 ng of RNA | |||
** Sterile water up to 13 uL | |||
* Heat at 65C for 5 minutes | |||
* Briefly centrifugre then add (per reaction): | |||
** 4 uL 5X First Strand Buffer | |||
** 1 uL 0.1M DTT | |||
** 1 uL RNAseOUT | |||
** 1 uL of Superscript III RT | |||
* Mix gently by pipetting and place in the PCR machine for the following program: | |||
** Incubate at 50C for 60 min | |||
** Inactivate by heating at 70C for 15 min | |||
===qPCR=== | ===qPCR=== | ||
* | * Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture). | ||
* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences. | * The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences. | ||
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization. | * The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization. | ||
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification | |||