Difference between revisions of "Nr3c1 Genotyping"

Revision as of 15:07, 5 June 2020

Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in Genotyping Box are marked with a star.

Revision as of 15:07, 5 June 2020 (view source) Reddj (Talk \| contribs) ← Older edit		Revision as of 15:07, 5 June 2020 (view source) Reddj (Talk \| contribs) Newer edit →
Line 3:		Line 3:
	*Rev: TGCCTGCTAGGCAAATGATCT		*Rev: TGCCTGCTAGGCAAATGATCT

−	Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in Genotyping Box are marked with a star.	+	Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in '''Genotyping Box''' are marked with a star.