Difference between revisions of "Nr3c1 Genotyping"

Revision as of 15:06, 5 June 2020

Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in *Genotyping Box* are marked with a star.

Revision as of 15:04, 5 June 2020 (view source) Reddj (Talk \| contribs) (created page)		Revision as of 15:06, 5 June 2020 (view source) Reddj (Talk \| contribs) Newer edit →
Line 3:		Line 3:
	*Rev: TGCCTGCTAGGCAAATGATCT		*Rev: TGCCTGCTAGGCAAATGATCT

−	~~make~~ primer dilution at 1uM (10uL each primer + 980uL water)	+	Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in Genotyping Box are marked with a star.