Quantification of miRNA by SYBR Green qPCR: Difference between revisions

Line 8:

* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]

* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)

* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''

* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM

* dNTP Mixture (10 mM of each)

* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''

* Mature miRNA Primer

Line 14:

Line 15:

==Protocol==

===Reverse Transcriptase==

===Reverse Transcriptase===

* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer

* Add to a PCR tube (this is per reaction):

** 1 uL of Oligo dT Primer

** 1uL of dNTP

** 500 ng of RNA

** Sterile water up to 13 uL

* Heat at 65C for 5 minutes

* Briefly centrifugre then add (per reaction):

** 4 uL 5X First Strand Buffer

** 1 uL 0.1M DTT

** 1 uL RNAseOUT

** 1 uL of Superscript III RT

* Mix gently by pipetting and place in the PCR machine for the following program:

** Incubate at 50C for 60 min

** Inactivate by heating at 70C for 15 min

===qPCR===

* ~~40ng~~ of cDNA was ~~used~~ as a template in each reaction.

* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).

* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.

* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.

* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

@@ Line 8: / Line 8: @@
 * Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
 * Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
-* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''
+* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
+* dNTP Mixture (10 mM of each)
 * Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
 * Mature miRNA Primer
@@ Line 14: / Line 15: @@
 ==Protocol==
-===Reverse Transcriptase==
+===Reverse Transcriptase===
 * Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
+* Add to a PCR tube (this is per reaction):
+** 1 uL of Oligo dT Primer
+** 1uL of dNTP
+** 500 ng of RNA
+** Sterile water up to 13 uL
+* Heat at 65C for 5 minutes
+* Briefly centrifugre then add (per reaction):
+** 4 uL 5X First Strand Buffer
+** 1 uL 0.1M DTT
+** 1 uL RNAseOUT
+** 1 uL of Superscript III RT
+* Mix gently by pipetting and place in the PCR machine for the following program:
+** Incubate at 50C for 60 min
+** Inactivate by heating at 70C for 15 min
 ===qPCR===
-* 40ng of cDNA was used as a template in each reaction.
+* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
 * The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
 * The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
+* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification