Quantification of miRNA by SYBR Green qPCR: Difference between revisions

(4 intermediate revisions by the same user not shown)

Line 2:

[[ Category: Molecular Biology ]]

[[ Category: Transcription ]]

__NOTOC__

~~This is adapted from Pfeffer ''et al'' 2015~~

see [[ SOP - Chloroform ]] for safety information about working with Chloroform.

This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]

==Materials==

* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]

* PolyA polymerase (NEB cat# M0276S)

* Phenol/Choroform mixture (1:1 ratio)

* 3M Sodium acetate pH 5.2

* Isopropanol

* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)

* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''

* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM

* dNTP Mixture (10 mM of each). Note this is not the normal 1 mM dNTP stock in the lab.

* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''

* Mature miRNA Primer

* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.

==Protocol==

===Reverse Transcriptase==

===PolyA Tailing of RNA===

* Incubate at 37°C for 1 hour. Components include

** 1 ug RNA

** 2 uL 10X polymerase reaction buffer

** 2 uL ATP (10 mM, comes with polymerase)

** 1 uL poly(A) polymerase

** ddH2O to a final volume of 20 uL

* Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion

* Centrifuge for 1 min on max to separate layers

* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol

* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins

* Redissolved in 6 μL of water

===Reverse Transcriptase===

* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer

* Add to an eppendorf tube (this is per reaction):

** 1 uL of miRNA Oligo dT Adapter Primer

** 1uL of dNTP

** 6uL of tailed RNA

** 5 uL Sterile water

* Heat at 65C for 5 minutes in the heating block.

* Briefly centrifuge then transfer to a PCR tube and add (per reaction):

** 4 uL 5X First Strand Buffer

** 1 uL 0.1M DTT

** 1 uL RNAseOUT

** 1 uL of Superscript III RT

* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):

** Incubate at 50C for 60 min

** Inactivate by heating at 70C for 15 min

* Can store the tailed cDNA at -20 until qPCR

===qPCR===

* ~~40ng~~ of cDNA was ~~used~~ as a template in each reaction.

* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).

* The reverse primer was from the adapter sequence: 5'~~GCGAGCACAGAATTAATACGACTCAC3~~' and the forward primers were specific to miRNA mature sequences.

* The reverse primer was from the adapter sequence: 5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.

* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.

* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

@@ Line 2: / Line 2: @@
 [[ Category: Molecular Biology ]]
 [[ Category: Transcription ]]
+__NOTOC__
-This is adapted from Pfeffer ''et al'' 2015
+see [[ SOP - Chloroform ]] for safety information about working with Chloroform.
+This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]
 ==Materials==
 * Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
+* PolyA polymerase (NEB cat# M0276S)
+* Phenol/Choroform mixture (1:1 ratio)
+* 3M Sodium acetate pH 5.2
+* Isopropanol
 * Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
-* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''
+* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
+* dNTP Mixture (10 mM of each).  Note this is not the normal 1 mM dNTP stock in the lab.
 * Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
-* Mature miRNA Primer
+* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.
 ==Protocol==
-===Reverse Transcriptase==
+===PolyA Tailing of RNA===
+* Incubate at 37°C for 1 hour.  Components include
+** 1 ug RNA
+** 2 uL 10X polymerase reaction buffer
+** 2 uL ATP (10 mM, comes with polymerase)
+** 1 uL poly(A) polymerase
+** ddH2O to a final volume of 20 uL
+* Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion
+* Centrifuge for 1 min on max to separate layers
+* Transfer the upper (aqueous) layer to a clean tube.   Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
+* Add 140 uL of isopropanol, mix and incubate 5 minutes.  Centrifuge 15 minutes on max.  Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
+* Redissolved in 6 μL of water
+===Reverse Transcriptase===
 * Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
+* Add to an eppendorf tube (this is per reaction):
+** 1 uL of miRNA Oligo dT Adapter Primer
+** 1uL of dNTP
+** 6uL of tailed RNA
+** 5 uL Sterile water
+* Heat at 65C for 5 minutes in the heating block.
+* Briefly centrifuge then transfer to a PCR tube and add (per reaction):
+** 4 uL 5X First Strand Buffer
+** 1 uL 0.1M DTT
+** 1 uL RNAseOUT
+** 1 uL of Superscript III RT
+* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):
+** Incubate at 50C for 60 min
+** Inactivate by heating at 70C for 15 min
+* Can store the tailed cDNA at -20 until qPCR
 ===qPCR===
-* 40ng of cDNA was used as a template in each reaction.
+* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
-* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
+* The reverse primer was from the adapter sequence:  5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.
 * The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
+* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification