Preparing an Adenoviral shRNA Clone: Difference between revisions

From Bridges Lab Protocols
Jump to navigationJump to search
added protocol links
Choosing a shRNA Sequence: updated XbaI compatible overhang
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
__NOTOC__
__NOTOC__
[[Category:shRNA]][[Category:Adenovirus]][[Category:Transduction]][[Category:Knockdown]][[Category:Molecular Biology]][[Category:Cloning]]
==Choosing a shRNA Sequence==
==Choosing a shRNA Sequence==
Use oligoengine to pick a sequence, for example
Use oligoengine to pick a sequence, for example
<span style="color:#FF0000">GATC</span><span style="color:#00FFFF">CCC</span>GAATACCGCAATGCCTTAG<span style="color:#FFD700">TTCAAGAGA</span>CTAAGGCATTGCGGTATTC<span style="color:#00FFFF">TTTTTA</span>
<span style="color:#FF0000">CTAG</span><span style="color:#00FFFF">CCC</span>GAATACCGCAATGCCTTAG<span style="color:#FFD700">TTCAAGAGA</span>CTAAGGCATTGCGGTATTC<span style="color:#00FFFF">TTTTTA</span>


Where:
Where:

Latest revision as of 19:47, 13 December 2010

Choosing a shRNA Sequence

Use oligoengine to pick a sequence, for example CTAGCCCGAATACCGCAATGCCTTAGTTCAAGAGACTAAGGCATTGCGGTATTCTTTTTA

Where:

  • BglII compatible overhang
  • Spacer
  • Loop
  • In black is the target shRNA sequence, both forward and then after the loop as a reverse complement.

For the reverse primer choose the reverse complement, remove the XbaI overhang from the 3' end (the last GATC sequence) and add an AGTC sequence to the 5' end (for HindIII). Order primers through IDT-DNA

Cloning Targetting Construct

Digestion of pAdtrack-H1 Promoter (or pSuper)

  1. If using a BglII/HindII do a sequential digestion
  2. Combine 1ug plasmid , 1uL HindIII and water/buffer to 50 uL (use NEB buffer 2)
  3. Incubate 1h at 37C
  4. Add 1uL BglII
  5. Incubate 2h at 37C
  6. There is no need to CIP treat, but this can be done if too many false positives are found.
  7. Gel purify the digested fragment and adjust to 0.2-0.5 mg/mL.

Annealing Primers

  1. Dissolve oligos to 3 mg/mL
  2. Combine 1 uL of each oligo + 48 uL annealing buffer (100 mM NaCl and 50 mM HEPES pH 7.4.) into a PCR tube.
  3. Run program annealing
    1. 90C for 4min
    2. 70C for 10min
    3. Gradient to 37C for 20 min
    4. 4C for storage
  4. Store at -20 or 4C

Ligation

  1. Combine 2uL annealed oligos with 1uL vector, 2.5uL 4X ligase buffer 4.5 uL water and 1 uL T4 Ligase
  2. Incubate overnight at room temperature
  3. Perform negative selection by adding 1 uL BglII and incubating at 37C for 30min (this removes single cut or uncut vector).
  4. Transform into subcloning efficiency DH5a cells

Checking for Positive Clones

  1. Miniprep clones
  2. Digest with EcoRI/HindIII for 1h
  3. Run on a gel. Positive clones are 281bp, negative clones are 227bp
  4. Sequence positive clones with pAdtrack sequencing primer.