Nr3c1 Genotyping: Difference between revisions

Revision as of 15:07, 5 June 2020 view source Reddj (talk \| contribs) 164 edits No edit summary ← Older edit		Revision as of 15:07, 5 June 2020 view source Reddj (talk \| contribs) 164 edits No edit summary Newer edit →
Line 3:		Line 3:
	*Rev: TGCCTGCTAGGCAAATGATCT		*Rev: TGCCTGCTAGGCAAATGATCT

	Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in Genotyping Box are marked with a star.		Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in '''Genotyping Box''' are marked with a star.