View source for Nr3c1 Genotyping

← Nr3c1 Genotyping

Jump to: navigation, search

You do not have permission to edit this page, for the following reason:

The action you have requested is limited to users in the group: Users.

You can view and copy the source of this page.

==PRIMERS==
*Fwd: AAACAGGGTTATGCTTGGCA
*Rev: TGCCTGCTAGGCAAATGATCT

Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in **Genotyping Box**  are marked with a star.

Return to Nr3c1 Genotyping.

Retrieved from "http://bridgeslab.sph.umich.edu/protocols/index.php/Nr3c1_Genotyping"