Vinexin Genotyping - Revision history

Davebrid: Added categories

2012-08-06T15:14:52Z

Added categories

← Older revision		Revision as of 15:14, 6 August 2012
Line 1:		Line 1:
			[[ Category:Genotyping ]]
			[[ Category:Mouse Work]]
			[[ Category:PCR]]
			[[ Category:DNA]]
			[[ Category:Molecular Biology]]

	From [http://dx.doi.org/10.1016/j.yexcr.2010.03.019 Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.]		From [http://dx.doi.org/10.1016/j.yexcr.2010.03.019 Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.]

Davebrid: Revised adding sections for Primers and PCR Program

2012-08-06T15:13:59Z

Revised adding sections for Primers and PCR Program

@@ Line 1: / Line 1: @@
 From [http://dx.doi.org/10.1016/j.yexcr.2010.03.019 Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.]
-==Genotyping of mice==
+==Primers==
 The genotypes of mutant mice were determined by nested PCR and confirmed by Southern blot analysis of genomic DNA from tail biopsies. Briefly, tail samples were incubated in lysis buffer (10 mM Tris (pH8.0), 150 mM NaCl, 10 mM EDTA, 0.1% SDS and 1 mg/ml proteinase K) at 55 °C for 4 h, followed by purification with phenol/chloroform and precipitation with isopropyl alcohol. The first PCR for nest PCR was performed using primers (F1 AAGCTGAGCGCAGAGCTGGACAAGGACCTG, R1 CCTGGAGTCTGCAGTTTCTAAGTCTCTCCC) under the following amplification conditions: 94 °C for 3 min, 25 cycles of 94 °C for 25 s, 65 °C for 25 s, and 72 °C for 150 s. A primer set (F2 TGCGAACTTTTCCGGAGGAGGTGGTGTCACTGG and R2 TCCCTACCTGTCTCTCTCACTCACCTCCAC) was used for the second PCR under the same amplification conditions to detect the wild-type allele (1.5 kb) and targeted allele (2.5 kb). In some experiments, another primer set (F2 and R3 TGGGTGGAAACATTCCAGGCCTGGGTGAGAGG) was used to detect the targeted allele only. For Southern blotting, SalI/EcoRI-digested genomic DNA was probed with a 0.4-kb fragment immediately upstream of the 5′ arm (Supplemental Fig. S1A, S1B).

Davebrid: pasted in protocol from Vinexin genotyping paper

2012-08-06T14:42:11Z

pasted in protocol from Vinexin genotyping paper

New page

From [http://dx.doi.org/10.1016/j.yexcr.2010.03.019 Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.]

==Genotyping of mice==
The genotypes of mutant mice were determined by nested PCR and confirmed by Southern blot analysis of genomic DNA from tail biopsies. Briefly, tail samples were incubated in lysis buffer (10 mM Tris (pH8.0), 150 mM NaCl, 10 mM EDTA, 0.1% SDS and 1 mg/ml proteinase K) at 55 °C for 4 h, followed by purification with phenol/chloroform and precipitation with isopropyl alcohol. The first PCR for nest PCR was performed using primers (F1 AAGCTGAGCGCAGAGCTGGACAAGGACCTG, R1 CCTGGAGTCTGCAGTTTCTAAGTCTCTCCC) under the following amplification conditions: 94 °C for 3 min, 25 cycles of 94 °C for 25 s, 65 °C for 25 s, and 72 °C for 150 s. A primer set (F2 TGCGAACTTTTCCGGAGGAGGTGGTGTCACTGG and R2 TCCCTACCTGTCTCTCTCACTCACCTCCAC) was used for the second PCR under the same amplification conditions to detect the wild-type allele (1.5 kb) and targeted allele (2.5 kb). In some experiments, another primer set (F2 and R3 TGGGTGGAAACATTCCAGGCCTGGGTGAGAGG) was used to detect the targeted allele only. For Southern blotting, SalI/EcoRI-digested genomic DNA was probed with a 0.4-kb fragment immediately upstream of the 5′ arm (Supplemental Fig. S1A, S1B).