Quantification of miRNA by SYBR Green qPCR - Revision history

Davebrid: updated with some clarifications

2017-03-01T15:24:16Z

updated with some clarifications

← Older revision		Revision as of 15:24, 1 March 2017
Line 6:		Line 6:
	see [[ SOP - Chloroform ]] for safety information about working with Chloroform.		see [[ SOP - Chloroform ]] for safety information about working with Chloroform.

	This is adapted from [http://dx.doi.org Yang ''et al'' 2010]		This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]
	==Materials==		==Materials==
	* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]		* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
Line 14:		Line 14:
	* Isopropanol		* Isopropanol
	* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)		* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
	* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM		* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
	* dNTP Mixture (10 mM of each)		* dNTP Mixture (10 mM of each). Note this is not the normal 1 mM dNTP stock in the lab.
	* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''		* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
	* Mature miRNA Primer		* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.

	==Protocol==		==Protocol==
Line 32:		Line 32:
	* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol		* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
	* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins		* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
	* ~~Reedissolved~~ in 25 μL of water		* Redissolved in 6 μL of water

	===Reverse Transcriptase===		===Reverse Transcriptase===
	* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer		* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
	* Add to ~~a PCR~~ tube (this is per reaction):		* Add to an eppendorf tube (this is per reaction):
	** 1 uL of Oligo dT Primer		** 1 uL of miRNA Oligo dT Adapter Primer
	** 1uL of dNTP		** 1uL of dNTP
	** 6uL of tailed RNA		** 6uL of tailed RNA
	** 5 uL Sterile water		** 5 uL Sterile water
	* Heat at 65C for 5 minutes		* Heat at 65C for 5 minutes in the heating block.
	* Briefly ~~centrifugre~~ then add (per reaction):		* Briefly centrifuge then transfer to a PCR tube and add (per reaction):
	** 4 uL 5X First Strand Buffer		** 4 uL 5X First Strand Buffer
	** 1 uL 0.1M DTT		** 1 uL 0.1M DTT
	** 1 uL RNAseOUT		** 1 uL RNAseOUT
	** 1 uL of Superscript III RT		** 1 uL of Superscript III RT
	* Mix gently by pipetting and place in the PCR machine for the following program:		* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):
	** Incubate at 50C for 60 min		** Incubate at 50C for 60 min
	** Inactivate by heating at 70C for 15 min		** Inactivate by heating at 70C for 15 min
			* Can store the tailed cDNA at -20 until qPCR

	===qPCR===		===qPCR===
	* ~~Try 50ng~~ of cDNA was as a template in each reaction (1/10th of the cDNA mixture).		* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
	* The reverse primer was from the adapter sequence: 5'~~GCGAGCACAGAATTAATACGACTCAC3~~' and the forward primers were specific to miRNA mature sequences.		* The reverse primer was from the adapter sequence: 5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.
	* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.		* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
	* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification		* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

Davebrid: Added RNA tailing

2017-01-10T19:01:53Z

Added RNA tailing

← Older revision		Revision as of 19:01, 10 January 2017
Line 3:		Line 3:
	[[ Category: Transcription ]]		[[ Category: Transcription ]]
	__NOTOC__		__NOTOC__

			see [[ SOP - Chloroform ]] for safety information about working with Chloroform.

	This is adapted from [http://dx.doi.org Yang ''et al'' 2010]		This is adapted from [http://dx.doi.org Yang ''et al'' 2010]
	==Materials==		==Materials==
	* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]		* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
			* PolyA polymerase (NEB cat# M0276S)
			* Phenol/Choroform mixture (1:1 ratio)
			* 3M Sodium acetate pH 5.2
			* Isopropanol
	* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)		* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
	* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM		* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
Line 13:		Line 20:

	==Protocol==		==Protocol==

			===PolyA Tailing of RNA===
			* Incubate at 37°C for 1 hour. Components include
			** 1 ug RNA
			** 2 uL 10X polymerase reaction buffer
			** 2 uL ATP (10 mM, comes with polymerase)
			** 1 uL poly(A) polymerase
			** ddH2O to a final volume of 20 uL
			* Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion
			* Centrifuge for 1 min on max to separate layers
			* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
			* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
			* Reedissolved in 25 μL of water

	===Reverse Transcriptase===		===Reverse Transcriptase===
Line 19:		Line 39:
	** 1 uL of Oligo dT Primer		** 1 uL of Oligo dT Primer
	** 1uL of dNTP		** 1uL of dNTP
	** ~~500 ng~~ of RNA		** 6uL of tailed RNA
	** Sterile water ~~up to 13 uL~~		** 5 uL Sterile water
	* Heat at 65C for 5 minutes		* Heat at 65C for 5 minutes
	* Briefly centrifugre then add (per reaction):		* Briefly centrifugre then add (per reaction):

Davebrid: Added link to Pfeffer article

2017-01-10T18:38:14Z

Added link to Pfeffer article

← Older revision		Revision as of 18:38, 10 January 2017
Line 3:		Line 3:
	[[ Category: Transcription ]]		[[ Category: Transcription ]]
	__NOTOC__		__NOTOC__
	This is adapted from ~~Pfeffer~~ ''et al'' ~~2015~~		This is adapted from [http://dx.doi.org Yang ''et al'' 2010]
	==Materials==		==Materials==
	* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]		* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]

Davebrid: removed table of contents

2015-07-20T21:16:22Z

removed table of contents

← Older revision		Revision as of 21:16, 20 July 2015
Line 2:		Line 2:
	[[ Category: Molecular Biology ]]		[[ Category: Molecular Biology ]]
	[[ Category: Transcription ]]		[[ Category: Transcription ]]
			__NOTOC__
	This is adapted from Pfeffer ''et al'' 2015		This is adapted from Pfeffer ''et al'' 2015

	==Materials==		==Materials==
	* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]		* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]

Davebrid: Filled in details about reverse transcriptase

2015-07-20T21:05:58Z

Filled in details about reverse transcriptase

← Older revision		Revision as of 21:05, 20 July 2015
Line 8:		Line 8:
	* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]		* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
	* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)		* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
	* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''		* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
			* dNTP Mixture (10 mM of each)
	* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''		* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
	* Mature miRNA Primer		* Mature miRNA Primer
Line 14:		Line 15:
	==Protocol==		==Protocol==

	===Reverse Transcriptase==		===Reverse Transcriptase===
	* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer		* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
			* Add to a PCR tube (this is per reaction):
			** 1 uL of Oligo dT Primer
			** 1uL of dNTP
			** 500 ng of RNA
			** Sterile water up to 13 uL
			* Heat at 65C for 5 minutes
			* Briefly centrifugre then add (per reaction):
			** 4 uL 5X First Strand Buffer
			** 1 uL 0.1M DTT
			** 1 uL RNAseOUT
			** 1 uL of Superscript III RT
			* Mix gently by pipetting and place in the PCR machine for the following program:
			** Incubate at 50C for 60 min
			** Inactivate by heating at 70C for 15 min

	===qPCR===		===qPCR===
	* ~~40ng~~ of cDNA was ~~used~~ as a template in each reaction.		* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
	* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.		* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
	* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.		* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
			* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

Davebrid: copied protocol from Pfeffer paper

2015-07-20T20:56:24Z

copied protocol from Pfeffer paper

New page

[[ Category: miRNA ]]
[[ Category: Molecular Biology ]]
[[ Category: Transcription ]]

This is adapted from Pfeffer ''et al'' 2015

==Materials==
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer

==Protocol==

===Reverse Transcriptase==
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
===qPCR===
* 40ng of cDNA was used as a template in each reaction.
* The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.