<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>https://bridgeslab.sph.umich.edu/protocols/index.php?action=history&amp;feed=atom&amp;title=Ppp1r3c_Genotyping</id>
	<title>Ppp1r3c Genotyping - Revision history</title>
	<link rel="self" type="application/atom+xml" href="https://bridgeslab.sph.umich.edu/protocols/index.php?action=history&amp;feed=atom&amp;title=Ppp1r3c_Genotyping"/>
	<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&amp;action=history"/>
	<updated>2026-07-09T16:52:40Z</updated>
	<subtitle>Revision history for this page on the wiki</subtitle>
	<generator>MediaWiki 1.45.1</generator>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&amp;diff=1604&amp;oldid=prev</id>
		<title>Reddj: created page</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&amp;diff=1604&amp;oldid=prev"/>
		<updated>2020-06-05T18:17:54Z</updated>

		<summary type="html">&lt;p&gt;created page&lt;/p&gt;
&lt;p&gt;&lt;b&gt;New page&lt;/b&gt;&lt;/p&gt;&lt;div&gt;==PRIMERS==&lt;br /&gt;
*Fwd: TGCTCTCCTTTTCTCCACGT&lt;br /&gt;
*Rev: CCGGACCTGAACCTTCTTCT&lt;br /&gt;
*Neo Rev: GCAGCGCATCGCCTTCTATC&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev}. PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
|1. Initiation/Melting || 95 || 3:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|2. Denaturation || 95 || 0:30 || 35 ||&lt;br /&gt;
|-&lt;br /&gt;
|3. Annealing || 60 || 1:00 || 35 ||&lt;br /&gt;
|-&lt;br /&gt;
|4. Elongation || 72 || 1:00 || 35 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
|5. Amplification || 72 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
</feed>