https://bridgeslab.sph.umich.edu/protocols/index.php?action=history&feed=atom&title=Ppp1r3c_Genotyping 2026-05-10T01:03:42Z Revision history for this page on the wiki MediaWiki 1.45.1 https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&diff=1604&oldid=prev 2020-06-05T18:17:54Z

<p>created page</p> <p><b>New page</b></p><div>==PRIMERS==<br /> *Fwd: TGCTCTCCTTTTCTCCACGT<br /> *Rev: CCGGACCTGAACCTTCTTCT<br /> *Neo Rev: GCAGCGCATCGCCTTCTATC<br /> <br /> Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev}. PCR primers separately.<br /> <br /> ==PCR PROTOCOL==<br /> {|border=&quot;1&quot;<br /> !| PCR Step || Temperature || Time || Cycles || Notes<br /> |-<br /> |1. Initiation/Melting || 95 || 3:00 || 1 ||<br /> |-<br /> |2. Denaturation || 95 || 0:30 || 35 ||<br /> |-<br /> |3. Annealing || 60 || 1:00 || 35 ||<br /> |-<br /> |4. Elongation || 72 || 1:00 || 35 || steps 2-4 to be run in sequence<br /> |-<br /> |5. Amplification || 72 || 5:00 || 1 ||<br /> |-<br /> |6. Finish || 4 || infinite || n/a ||<br /> |}<br /> <br /> [[ Category:Genotyping ]]<br /> [[ Category:Mouse Work]]<br /> [[ Category:PCR]]<br /> [[ Category:DNA]]<br /> [[ Category:Molecular Biology]]</div>

Reddj