<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>https://bridgeslab.sph.umich.edu/protocols/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Reddj</id>
	<title>Bridges Lab Protocols - User contributions [en]</title>
	<link rel="self" type="application/atom+xml" href="https://bridgeslab.sph.umich.edu/protocols/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Reddj"/>
	<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php/Special:Contributions/Reddj"/>
	<updated>2026-07-12T15:39:19Z</updated>
	<subtitle>User contributions</subtitle>
	<generator>MediaWiki 1.45.1</generator>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1650</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1650"/>
		<updated>2021-07-23T14:32:29Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added are band size&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Strain(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || aTSC, mTSC, Placenta TSC || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || Between 340-400kDa || aTSC, mTSC, Adipo-Raptor, Adipo-GR-KO, Placenta TSC, Placenta GR || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[SRY Genotyping| SRY]]|| [[Cre PCR ]] || Between 100-200kDa || any mice too young to sex visually || Only present in males&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]|| || || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || || || &lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || GR-KO and Adipo-GR-KO || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || mc4r || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || ppp1r3c (PTG) || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1= KO- 550bp, WT- 175bp; 2= KO- 750bp, WT- 450bp || 4EBP1/2 || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || GDF15 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
AMPK, fTSC, fRaptor, and C57Bl6/J are all wild-type mice and don&#039;t need to be genotyped.&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1649</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1649"/>
		<updated>2021-07-23T14:31:13Z</updated>

		<summary type="html">&lt;p&gt;Reddj: Added SRY&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Strain(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || aTSC, mTSC, Placenta TSC || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || aTSC, mTSC, Adipo-Raptor, Adipo-GR-KO, Placenta TSC, Placenta GR || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[SRY Genotyping| SRY]]|| [[Cre PCR ]] || Between 100-200kDa || any mice too young to sex visually || Only present in males&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]|| || || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || || || &lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || GR-KO and Adipo-GR-KO || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || mc4r || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || ppp1r3c (PTG) || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1= KO- 550bp, WT- 175bp; 2= KO- 750bp, WT- 450bp || 4EBP1/2 || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || GDF15 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
AMPK, fTSC, fRaptor, and C57Bl6/J are all wild-type mice and don&#039;t need to be genotyped.&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=SRY_Genotyping&amp;diff=1648</id>
		<title>SRY Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=SRY_Genotyping&amp;diff=1648"/>
		<updated>2021-07-23T14:30:57Z</updated>

		<summary type="html">&lt;p&gt;Reddj: Create SRY&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
SRY&lt;br /&gt;
*Fwd: &lt;br /&gt;
*Rev: &lt;br /&gt;
&lt;br /&gt;
Make SRY primer dilution at 1uM (10uL each primer + 980uL water). Primers in &#039;&#039;&#039;Genotyping Box&#039;&#039;&#039; .&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Weigh-Suckle-Weigh_Milk_Volume_Measurement&amp;diff=1647</id>
		<title>Weigh-Suckle-Weigh Milk Volume Measurement</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Weigh-Suckle-Weigh_Milk_Volume_Measurement&amp;diff=1647"/>
		<updated>2021-04-08T17:42:32Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Weigh-Suckle-Weigh Protocol at PND10.5&lt;br /&gt;
&lt;br /&gt;
* This is usually done at PND10.5 (Usually denote PND0.5 as the day pups were born).&lt;br /&gt;
* Weigh dam alone using the regular metric weighing scale (in the procedure room) and weigh aggregate of pups by placing all pups on weighing paper using the analytical scale (in the lab).&lt;br /&gt;
* Keep the dam in the original cage with food and water bottle ad-lib.  Place pups in a new cage without food or water, but keep the normal cage enrichment (the bedding pouch, tear it open, and put it on top of pups as a blanket).&lt;br /&gt;
* Put the pup cage on a heating pad (set heat to “high”) so they will remain warm for the separation period. Put ¾ of the cage on the pad and leave a ¼ on the silver bench so pups can choose to move around if they get too warm. I usually place the dam’s cage next to the pups with the similar ¾ ¼ alignment on the heating pad and bench, respectively. &lt;br /&gt;
* Keep the pups and dam separated for two hours.&lt;br /&gt;
* After two hours of separation, weigh the pup aggregate weight on the analytical scale and weigh the dam using the metric weighing scale.&lt;br /&gt;
* Recombine the pups and dam in the original cage.&lt;br /&gt;
* After one hour of nursing, weigh the dam again using the metric weighing scale then weigh the aggregate of pups using the analytical scale.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Note 1: &lt;br /&gt;
* The data collected should look something like this for the dam and pups for all time points. This is an example to highlight the 3 data points for weight measurements.&lt;br /&gt;
Dam wt 26.9g ---&amp;gt; after 2 hour separation 25.7g ---&amp;gt; after 1 hour nursing 25.0&lt;br /&gt;
&lt;br /&gt;
Pups wt 22.71 ---&amp;gt; after 2 hour separation 22.55 ---&amp;gt; after 1 hour nursing 23.20g&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
Note 2: &lt;br /&gt;
* The weight of the dam may decrease after 2-hour separation from pups, do not worry about that (despite assuming the dam should retain more milk and gain weight).&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Western_Blotting&amp;diff=1646</id>
		<title>Western Blotting</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Western_Blotting&amp;diff=1646"/>
		<updated>2021-03-26T15:58:22Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*Irritant&lt;br /&gt;
*Electrophoresis&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Transfer Buffer (200 mL Methanol, 100 mL 10X [[ Transfer Buffer ]] to final 1L volume)&lt;br /&gt;
*Transfer Apparatus, either Bio-Rad or Invitrogen&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
#Turn on heat block to 85 degrees&lt;br /&gt;
#Run SDS-PAGE gel using [[ SDS-PAGE Running Buffer ]] and prepare diluted transfer buffer&lt;br /&gt;
## Use a prepared 4-12% tris gel (in the 4 degree). Remove it from the packaging, remove the white strip of tape from the bottom back, and gently pull the comb out and rinse with water.&lt;br /&gt;
##Load into gel tank. Fill with SDS page Running buffer (1X) to the fill line in the front and halfway up the back&lt;br /&gt;
##Boil sample at 85 degrees for ~3 min&lt;br /&gt;
##Load 3 microliters of protein ladder (purple top) (in the 4 degree), and 10 microliters of each sample into separate wells.&lt;br /&gt;
## Place top on tank, plug into power source and run at 125 Volts until samples and ladder reach the bottom of the gel. (Tip: Gel runs more evenly if you start a lower V and increase once the samples have run down 1/3 of the gel.)&lt;br /&gt;
#Make sandwich (black side, sponge, filter paper, gel, nitrocellulose, filter paper, sponge, clear side), ensuring no bubbles between layers with black piece on bottom and layer as above.  Place in apparatus so that the black sandwich touches the black transfer piece.  Fill with transfer buffer.  &lt;br /&gt;
#Transfer 4h at 75V (in cold room) or overnight at 35V (room temp with an ice pack).&lt;br /&gt;
#Stain for total protein with Revert total protein stain on rocker for 5 minutes --when finished pour total protein stain back in bottle for later use!&lt;br /&gt;
#Rinse twice in revert wash solution (60ml MeOH, 13.4 ml Acetic Acid, 126.6 ml Water)&lt;br /&gt;
#Scan using licor for total protein, which will be used to normalize the blot&lt;br /&gt;
#Rinse nitrocellulose in revert reversal solution for at least 5 and no more than 10 minutes until nitrocellulose appears clear again (.2g NaOH, 60ml MeOH, 140ml Water)&lt;br /&gt;
#Rinse nitrocellulose in 2% BSA (2g BSA in 100ml TBST, stored in fridge) for 1 hour&lt;br /&gt;
#Incubate with primary antibody (check for dilution) in 2% BSA for &amp;gt;1h &lt;br /&gt;
#Wash blot every 5 minutes for 15 min with TBST.&lt;br /&gt;
#Incubate with appropriate secondary antibody (10 000X) for 45min-1h (20 ml 2% BSA 1ul of both secondary antibodies, all found in fridge Ab stocks with blue dots on top)&lt;br /&gt;
#Wash blot every 5 minutes for 15 min with TBST.&lt;br /&gt;
#Rinse once or twice with double distilled water.&lt;br /&gt;
#Scan dry blot using the LiCor Odyssey [[Scanning and Analyzing Western Blots Using LiCor Odyssey]].&lt;br /&gt;
&lt;br /&gt;
==If Using LiCor==&lt;br /&gt;
&lt;br /&gt;
[[Scanning and Analyzing Western Blots Using LiCor Odyssey]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category: Western Blotting ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1645</id>
		<title>Scanning and Analyzing Western Blots Using LiCor Odyssey</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1645"/>
		<updated>2021-03-26T15:51:57Z</updated>

		<summary type="html">&lt;p&gt;Reddj: /* Analysis/Quantification */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Materials==&lt;br /&gt;
*LiCor Odyssey (with rubber mat)&lt;br /&gt;
*Dry Western Blot&lt;br /&gt;
*Roller&lt;br /&gt;
*Plastic forceps (attached to Odyssey)&lt;br /&gt;
*DI water&lt;br /&gt;
*KimWipes&lt;br /&gt;
*USB (for data and pictures)&lt;br /&gt;
&lt;br /&gt;
==Getting Started==&lt;br /&gt;
#Clean glass scanning surface of the Odyssey gently with DI water and KimWipes to remove any dust or debris.&lt;br /&gt;
#Open &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; (yellow icon on desktop). Click on or create (using your last name) your &#039;&#039;&#039;Work Area&#039;&#039;&#039;.&lt;br /&gt;
&lt;br /&gt;
==Image Aqusition Protocol==&lt;br /&gt;
#Place blot (wet membrane if scanning for total protein, dry membrane if scanning finished blot) on scanner, protein side down.  Cover with clear rubber mat and roll with roller to remove any air pockets. Take mental note of where your blot is on the ruler on the scanning surface.&lt;br /&gt;
#With the &#039;&#039;&#039;Acquire&#039;&#039; tab selected, click on the blue box in the large white-grid working space and drag edges to fit around your blot. (Tip: Note the coordinates of your blot using the ruler-as above-and set blue box wider that blot initially).&lt;br /&gt;
#Click &#039;&#039;&#039;Preview&#039;&#039;&#039; on the top right menu bar (blue circle with magnifying glass) to scan a preliminary, low resolution image.  Use this image to capture all of the blot. Adjust and re-scan with preview as needed.  After the scan is complete, a pop-up menu with come up to adjust the image. Click &#039;&#039;&#039;Cancel&#039;&#039;&#039;.&lt;br /&gt;
#Add specifics to the image table (antibody, experiment, name of file: yy-mm-dd_nameofexperiment).&lt;br /&gt;
#Adjust the blue box to fit just around your blot. &lt;br /&gt;
#Re-scan for a  high-resolution image by cliking &#039;&#039;&#039;Start&#039;&#039;&#039; on the top right menu bar (green circle with power button icon). Press &#039;&#039;&#039;Cancel&#039;&#039;&#039; on the image-adjuster pop-up.&lt;br /&gt;
&lt;br /&gt;
==Analysis/Quantification==&lt;br /&gt;
#With the &#039;&#039;&#039;Image&#039;&#039;&#039; tab selected, select the image you want to analyze from the table at the bottom.&lt;br /&gt;
#You can flip, rotate, and straighten the image to better align the lanes using &#039;&#039;&#039;Rotate or Flip&#039;&#039;&#039; and  &#039;&#039;&#039;Free Rotate&#039;&#039; in the top center menu.  Using these tools will automatically create a new, adjusted image with a description of the changes from the original in the &#039;&#039;&#039;Images&#039;&#039;&#039; table.&lt;br /&gt;
#With the &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab selected, Select &#039;&#039;&#039;Western&amp;quot;&#039; as a &#039;&#039;&#039;Type&#039;&#039;&#039; on the leftmost side of the menu bar. This will create a second &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab.&lt;br /&gt;
#Adjust the &#039;&#039;&#039;Number&#039;&#039;&#039; of &#039;&#039;&#039;Lanes&#039;&#039;&#039; on the far left of the menu bar to fit your blot.&lt;br /&gt;
#Click &#039;&#039;&#039;Redraw Boundaries&#039;&#039;&#039; and drab the boundary to include all lanes (not ladder(s)).&lt;br /&gt;
#To select the bands of interest, select the &#039;&#039;&#039;700 or 800 channel&#039;&#039;&#039; by clicking the &#039;&#039;&#039;X&#039;&#039;&#039; box next to the channel on the right side of the screen (with the vertical &#039;&#039;&#039;Display&#039;&#039;&#039; tab selected). Add boxes to your bands (see below) and repeat for each channel.  Each band of interest should have one box around it.&lt;br /&gt;
##You can use &#039;&#039;&#039;Add&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu in the top center menu bar to add boxes around individual bands to be quantified. &lt;br /&gt;
##Or you can use &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to add bands of one size across all lanes. This is much faster if you have many lanes.&lt;br /&gt;
#Click &#039;&#039;&#039;Select&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu.&lt;br /&gt;
#Click the vertical &#039;&#039;&#039;Profiles&#039;&#039;&#039; tab (below the &#039;&#039;&#039;Display&#039;&#039;&#039; tab.  Adjust the edges of the boxes around each band to include the entire band using the graphs.  Each edge should be on the axis and should capture the desired peak(s).&lt;br /&gt;
#Once all bands are adjusted, click the &#039;&#039;&#039;Western Bands&#039;&#039;&#039; tab within the table at the bottom of the screen.&lt;br /&gt;
#Click the triangle in the top left corner of the table to copy the table (or the lanes you want).  Copy into an Excel spreadsheet or a Text file to use in Excel on your own computer.&lt;br /&gt;
##Use this format: yy_mm_dd_nameofexperiment_quantification&lt;br /&gt;
#Save your work/&#039;&#039;&#039;Work Area&#039;&#039;&#039; within &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; and save pictures (without features) to your flash drive.  You can remove the features by unchecking the boxes in the &#039;&#039;&#039;Show&#039;&#039;&#039; menu bar on the right of the top menu bar.&lt;br /&gt;
##For the former, click the &#039;&#039;&#039;disk icon&#039;&#039;&#039; at the top the screen.&lt;br /&gt;
##For the latter, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039; circle at the top left of the screen and select &#039;&#039;&#039;Export&#039;&#039;&#039; and &#039;&#039;&#039;Image for Print&#039;&#039;&#039;.  Save as &#039;&#039;&#039;TIFF&#039;&#039;&#039;, &#039;&#039;&#039;PNG&#039;&#039;&#039;, or &#039;&#039;&#039;PDF&#039;&#039;&#039; as needed. (Note: Save pictures in greyscale by clicking the greyscale box in the &#039;&#039;&#039;Display&#039;&#039;&#039; tab above &#039;&#039;&#039;Profiles&#039;&#039;&#039; (see #6).&lt;br /&gt;
##You can also save everything in to a &#039;&#039;&#039;Lab Notebook&#039;&#039;&#039; as a PDF using the &#039;&#039;&#039;Lab Book&#039;&#039;&#039; tab in the top menu.&lt;br /&gt;
&lt;br /&gt;
Note: To quantify the total protein scan, use steps 4-7, but with adjustments to 7.&lt;br /&gt;
#Once the boundary is set, click &#039;&#039;&#039;Add&#039;&#039;&#039; or &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; to each of your bands of interest. You&#039;ll only do this in the &#039;&#039;&#039;700 channel&#039;&#039;&#039;, as the total protein stain is only for the &#039;&#039;&#039;700 channel&#039;&#039;&#039;.&lt;br /&gt;
#Control+Click to select all bands in one lane and click &#039;&#039;&#039;Merge&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to create one box around the lane.  &lt;br /&gt;
#Adjust the edges, as above.&lt;br /&gt;
#Use the &#039;&#039;&#039;Western Bands&#039;&#039;&#039;&#039; tab, as above to copy the quantification values (see #9).&lt;br /&gt;
&lt;br /&gt;
==Finishing Up==&lt;br /&gt;
#Check that you have collected and saved all data and pictures to your &#039;&#039;&#039;Work Area&#039;&#039;&#039; and to your flash drive (later transfer to the shared drive).&lt;br /&gt;
#Either close our your &#039;&#039;&#039;Work Area&#039;&#039;&#039; or close the program.&lt;br /&gt;
*For the former, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039;--&amp;gt; &#039;&#039;&#039;Work Area&#039;&#039;&#039;--&amp;gt;&#039;&#039;&#039;Switch&#039;&#039;&#039;.&lt;br /&gt;
#Collect blots and save in tin foil with notes in your lab notebook.&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1644</id>
		<title>Scanning and Analyzing Western Blots Using LiCor Odyssey</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1644"/>
		<updated>2021-03-26T15:51:23Z</updated>

		<summary type="html">&lt;p&gt;Reddj: /* Analysis/Quantification */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Materials==&lt;br /&gt;
*LiCor Odyssey (with rubber mat)&lt;br /&gt;
*Dry Western Blot&lt;br /&gt;
*Roller&lt;br /&gt;
*Plastic forceps (attached to Odyssey)&lt;br /&gt;
*DI water&lt;br /&gt;
*KimWipes&lt;br /&gt;
*USB (for data and pictures)&lt;br /&gt;
&lt;br /&gt;
==Getting Started==&lt;br /&gt;
#Clean glass scanning surface of the Odyssey gently with DI water and KimWipes to remove any dust or debris.&lt;br /&gt;
#Open &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; (yellow icon on desktop). Click on or create (using your last name) your &#039;&#039;&#039;Work Area&#039;&#039;&#039;.&lt;br /&gt;
&lt;br /&gt;
==Image Aqusition Protocol==&lt;br /&gt;
#Place blot (wet membrane if scanning for total protein, dry membrane if scanning finished blot) on scanner, protein side down.  Cover with clear rubber mat and roll with roller to remove any air pockets. Take mental note of where your blot is on the ruler on the scanning surface.&lt;br /&gt;
#With the &#039;&#039;&#039;Acquire&#039;&#039; tab selected, click on the blue box in the large white-grid working space and drag edges to fit around your blot. (Tip: Note the coordinates of your blot using the ruler-as above-and set blue box wider that blot initially).&lt;br /&gt;
#Click &#039;&#039;&#039;Preview&#039;&#039;&#039; on the top right menu bar (blue circle with magnifying glass) to scan a preliminary, low resolution image.  Use this image to capture all of the blot. Adjust and re-scan with preview as needed.  After the scan is complete, a pop-up menu with come up to adjust the image. Click &#039;&#039;&#039;Cancel&#039;&#039;&#039;.&lt;br /&gt;
#Add specifics to the image table (antibody, experiment, name of file: yy-mm-dd_nameofexperiment).&lt;br /&gt;
#Adjust the blue box to fit just around your blot. &lt;br /&gt;
#Re-scan for a  high-resolution image by cliking &#039;&#039;&#039;Start&#039;&#039;&#039; on the top right menu bar (green circle with power button icon). Press &#039;&#039;&#039;Cancel&#039;&#039;&#039; on the image-adjuster pop-up.&lt;br /&gt;
&lt;br /&gt;
==Analysis/Quantification==&lt;br /&gt;
#With the &#039;&#039;&#039;Image&#039;&#039;&#039; tab selected, select the image you want to analyze from the table at the bottom.&lt;br /&gt;
#You can flip, rotate, and straighten the image to better align the lanes using &#039;&#039;&#039;Rotate or Flip&#039;&#039;&#039; and  &#039;&#039;&#039;Free Rotate&#039;&#039; in the top center menu.  Using these tools will automatically create a new, adjusted image with a description of the changes from the original in the &#039;&#039;&#039;Images&#039;&#039;&#039; table.&lt;br /&gt;
#With the &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab selected, Select &#039;&#039;&#039;Western&amp;quot;&#039; as a &#039;&#039;&#039;Type&#039;&#039;&#039; on the leftmost side of the menu bar. This will create a second &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab.&lt;br /&gt;
#Adjust the &#039;&#039;&#039;Number&#039;&#039;&#039; of &#039;&#039;&#039;Lanes&#039;&#039;&#039; on the far left of the menu bar to fit your blot.&lt;br /&gt;
#Click &#039;&#039;&#039;Redraw Boundaries&#039;&#039;&#039; and drab the boundary to include all lanes (not ladder(s)).&lt;br /&gt;
#To select the bands of interest, select the &#039;&#039;&#039;700 or 800 channel&#039;&#039;&#039; by clicking the &#039;&#039;&#039;X&#039;&#039;&#039; box next to the channel on the right side of the screen (with the vertical &#039;&#039;&#039;Display&#039;&#039;&#039; tab selected). Add boxes to your bands (see below) and repeat for each channel.  Each band of interest should have one box around it.&lt;br /&gt;
##You can use &#039;&#039;&#039;Add&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu in the top center menu bar to add boxes around individual bands to be quantified. &lt;br /&gt;
##Or you can use &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to add bands of one size across all lanes. This is much faster if you have many lanes.&lt;br /&gt;
#Click &#039;&#039;&#039;Select&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu.&lt;br /&gt;
#Click the vertical &#039;&#039;&#039;Profiles&#039;&#039;&#039; tab (below the &#039;&#039;&#039;Display&#039;&#039;&#039; tab.  Adjust the edges of the boxes around each band to include the entire band using the graphs.  Each edge should be on the axis and should capture the desired peak(s).&lt;br /&gt;
#Once all bands are adjusted, click the &#039;&#039;&#039;Western Bands&#039;&#039;&#039; tab within the table at the bottom of the screen.&lt;br /&gt;
#Click the triangle in the top left corner of the table to copy the table (or the lanes you want).  Copy into an Excel spreadsheet or a Text file to use in Excel on your own computer.&lt;br /&gt;
##Use this format: yy_mm_dd_nameofexperiment_quantification&lt;br /&gt;
#Save your work/&#039;&#039;&#039;Work Area&#039;&#039;&#039; within &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; and save pictures (without features) to your flash drive.  You can remove the features by unchecking the boxes in the &#039;&#039;&#039;Show&#039;&#039;&#039; menu bar on the right of the top menu bar.&lt;br /&gt;
##For the former, click the &#039;&#039;&#039;disk icon&#039;&#039;&#039; at the top the screen.&lt;br /&gt;
##For the latter, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039; circle at the top left of the screen and select &#039;&#039;&#039;Export&#039;&#039;&#039; and &#039;&#039;&#039;Image for Print&#039;&#039;&#039;.  Save as &#039;&#039;&#039;TIFF&#039;&#039;&#039;, &#039;&#039;&#039;PNG&#039;&#039;&#039;, or &#039;&#039;&#039;PDF&#039;&#039;&#039; as needed. (Note: Save pictures in greyscale by clicking the greyscale box in the &#039;&#039;&#039;Display&#039;&#039;&#039; tab above &#039;&#039;&#039;Profiles&#039;&#039;&#039; (see #6).&lt;br /&gt;
##You can also save everything in to a &#039;&#039;&#039;Lab Notebook&#039;&#039;&#039; as a PDF using the &#039;&#039;&#039;Lab Book&#039;&#039;&#039; tab in the top menu.&lt;br /&gt;
&lt;br /&gt;
Note: To quantify the total protein scan, use steps 4-7, but with adjustments to 7.&lt;br /&gt;
#Once the boundary is set, click &#039;&#039;&#039;Add&#039;&#039;&#039; or &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; to each of your bands of interest. You&#039;ll only do this in the &#039;&#039;&#039;700 channel&#039;&#039;&#039;, as the total protein stain is only for the &#039;&#039;&#039;700 channel&#039;&#039;&#039;.&lt;br /&gt;
#Control+Click to select all bands in one lane and click &#039;&#039;&#039;Merge&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to create one box around the lane.  &lt;br /&gt;
#Adjust the edges, as above.&lt;br /&gt;
#Use the &#039;&#039;&#039;Western Bands&#039;&#039;&#039;&#039; tab, as above to copy the quantification values (see #10).&lt;br /&gt;
&lt;br /&gt;
==Finishing Up==&lt;br /&gt;
#Check that you have collected and saved all data and pictures to your &#039;&#039;&#039;Work Area&#039;&#039;&#039; and to your flash drive (later transfer to the shared drive).&lt;br /&gt;
#Either close our your &#039;&#039;&#039;Work Area&#039;&#039;&#039; or close the program.&lt;br /&gt;
*For the former, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039;--&amp;gt; &#039;&#039;&#039;Work Area&#039;&#039;&#039;--&amp;gt;&#039;&#039;&#039;Switch&#039;&#039;&#039;.&lt;br /&gt;
#Collect blots and save in tin foil with notes in your lab notebook.&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1643</id>
		<title>Scanning and Analyzing Western Blots Using LiCor Odyssey</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Scanning_and_Analyzing_Western_Blots_Using_LiCor_Odyssey&amp;diff=1643"/>
		<updated>2021-03-26T15:50:06Z</updated>

		<summary type="html">&lt;p&gt;Reddj: protocol on how to use the licor&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==Materials==&lt;br /&gt;
*LiCor Odyssey (with rubber mat)&lt;br /&gt;
*Dry Western Blot&lt;br /&gt;
*Roller&lt;br /&gt;
*Plastic forceps (attached to Odyssey)&lt;br /&gt;
*DI water&lt;br /&gt;
*KimWipes&lt;br /&gt;
*USB (for data and pictures)&lt;br /&gt;
&lt;br /&gt;
==Getting Started==&lt;br /&gt;
#Clean glass scanning surface of the Odyssey gently with DI water and KimWipes to remove any dust or debris.&lt;br /&gt;
#Open &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; (yellow icon on desktop). Click on or create (using your last name) your &#039;&#039;&#039;Work Area&#039;&#039;&#039;.&lt;br /&gt;
&lt;br /&gt;
==Image Aqusition Protocol==&lt;br /&gt;
#Place blot (wet membrane if scanning for total protein, dry membrane if scanning finished blot) on scanner, protein side down.  Cover with clear rubber mat and roll with roller to remove any air pockets. Take mental note of where your blot is on the ruler on the scanning surface.&lt;br /&gt;
#With the &#039;&#039;&#039;Acquire&#039;&#039; tab selected, click on the blue box in the large white-grid working space and drag edges to fit around your blot. (Tip: Note the coordinates of your blot using the ruler-as above-and set blue box wider that blot initially).&lt;br /&gt;
#Click &#039;&#039;&#039;Preview&#039;&#039;&#039; on the top right menu bar (blue circle with magnifying glass) to scan a preliminary, low resolution image.  Use this image to capture all of the blot. Adjust and re-scan with preview as needed.  After the scan is complete, a pop-up menu with come up to adjust the image. Click &#039;&#039;&#039;Cancel&#039;&#039;&#039;.&lt;br /&gt;
#Add specifics to the image table (antibody, experiment, name of file: yy-mm-dd_nameofexperiment).&lt;br /&gt;
#Adjust the blue box to fit just around your blot. &lt;br /&gt;
#Re-scan for a  high-resolution image by cliking &#039;&#039;&#039;Start&#039;&#039;&#039; on the top right menu bar (green circle with power button icon). Press &#039;&#039;&#039;Cancel&#039;&#039;&#039; on the image-adjuster pop-up.&lt;br /&gt;
&lt;br /&gt;
==Analysis/Quantification==&lt;br /&gt;
#With the &#039;&#039;&#039;Image&#039;&#039;&#039; tab selected, select the image you want to analyze from the table at the bottom.&lt;br /&gt;
#You can flip, rotate, and straighten the image to better align the lanes using &#039;&#039;&#039;Rotate or Flip&#039;&#039;&#039; and  &#039;&#039;&#039;Free Rotate&#039;&#039; in the top center menu.  Using these tools will automatically create a new, adjusted image with a description of the changes from the original in the &#039;&#039;&#039;Images&#039;&#039;&#039; table.&lt;br /&gt;
#With the &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab selected, Select &#039;&#039;&#039;Western&amp;quot;&#039; as a &#039;&#039;&#039;Type&#039;&#039;&#039; on the leftmost side of the menu bar. This will create a second &#039;&#039;&#039;Analysis&#039;&#039;&#039; tab.&lt;br /&gt;
#Adjust the &#039;&#039;&#039;Number&#039;&#039;&#039; of &#039;&#039;&#039;Lanes&#039;&#039;&#039; on the far left of the menu bar to fit your blot.&lt;br /&gt;
#Click &#039;&#039;&#039;Redraw Boundaries&#039;&#039;&#039; and drab the boundary to include all lanes (not ladder(s)).&lt;br /&gt;
#To select the bands of interest, select the &#039;&#039;&#039;700 or 800 channel&#039;&#039;&#039; by clicking the &#039;&#039;&#039;X&#039;&#039;&#039; box next to the channel on the right side of the screen (with the vertical &#039;&#039;&#039;Display&#039;&#039;&#039; tab selected). Add boxes to your bands (see below) and repeat for each channel.  Each band of interest should have one box around it.&lt;br /&gt;
*You can use &#039;&#039;&#039;Add&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu in the top center menu bar to add boxes around individual bands to be quantified. &lt;br /&gt;
*Or you can use &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to add bands of one size across all lanes. This is much faster if you have many lanes.&lt;br /&gt;
#Click &#039;&#039;&#039;Select&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu.&lt;br /&gt;
#Click the vertical &#039;&#039;&#039;Profiles&#039;&#039;&#039; tab (below the &#039;&#039;&#039;Display&#039;&#039;&#039; tab.  Adjust the edges of the boxes around each band to include the entire band using the graphs.  Each edge should be on the axis and should capture the desired peak(s).&lt;br /&gt;
#Once all bands are adjusted, click the &#039;&#039;&#039;Western Bands&#039;&#039;&#039; tab within the table at the bottom of the screen.&lt;br /&gt;
#Click the triangle in the top left corner of the table to copy the table (or the lanes you want).  Copy into an Excel spreadsheet or a Text file to use in Excel on your own computer.&lt;br /&gt;
*Use this format: yy_mm_dd_nameofexperiment_quantification&lt;br /&gt;
#Save your work/&#039;&#039;&#039;Work Area&#039;&#039;&#039; within &#039;&#039;&#039;ImageStudio&#039;&#039;&#039; and save pictures (without features) to your flash drive.  You can remove the features by unchecking the boxes in the &#039;&#039;&#039;Show&#039;&#039;&#039; menu bar on the right of the top menu bar.&lt;br /&gt;
*For the former, click the &#039;&#039;&#039;disk icon&#039;&#039;&#039; at the top the screen.&lt;br /&gt;
*For the latter, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039; circle at the top left of the screen and select &#039;&#039;&#039;Export&#039;&#039;&#039; and &#039;&#039;&#039;Image for Print&#039;&#039;&#039;.  Save as &#039;&#039;&#039;TIFF&#039;&#039;&#039;, &#039;&#039;&#039;PNG&#039;&#039;&#039;, or &#039;&#039;&#039;PDF&#039;&#039;&#039; as needed. (Note: Save pictures in greyscale by clicking the greyscale box in the &#039;&#039;&#039;Display&#039;&#039;&#039; tab above &#039;&#039;&#039;Profiles&#039;&#039;&#039; (see #6).&lt;br /&gt;
*You can also save everything in to a &#039;&#039;&#039;Lab Notebook&#039;&#039;&#039; as a PDF using the &#039;&#039;&#039;Lab Book&#039;&#039;&#039; tab in the top menu.&lt;br /&gt;
&lt;br /&gt;
Note: To quantify the total protein scan, use steps 4-7, but with adjustments to 7.&lt;br /&gt;
#Once the boundary is set, click &#039;&#039;&#039;Add&#039;&#039;&#039; or &#039;&#039;&#039;Add to All Lanes&#039;&#039;&#039; to each of your bands of interest. You&#039;ll only do this in the &#039;&#039;&#039;700 channel&#039;&#039;&#039;, as the total protein stain is only for the &#039;&#039;&#039;700 channel&#039;&#039;&#039;.&lt;br /&gt;
#Control+Click to select all bands in one lane and click &#039;&#039;&#039;Merge&#039;&#039;&#039; in the &#039;&#039;&#039;Bands&#039;&#039;&#039; menu to create one box around the lane.  &lt;br /&gt;
#Adjust the edges, as above.&lt;br /&gt;
#Use the &#039;&#039;&#039;Western Bands&#039;&#039;&#039;&#039; tab, as above to copy the quantification values (see #10).&lt;br /&gt;
&lt;br /&gt;
==Finishing Up==&lt;br /&gt;
#Check that you have collected and saved all data and pictures to your &#039;&#039;&#039;Work Area&#039;&#039;&#039; and to your flash drive (later transfer to the shared drive).&lt;br /&gt;
#Either close our your &#039;&#039;&#039;Work Area&#039;&#039;&#039; or close the program.&lt;br /&gt;
*For the former, click the yellow &#039;&#039;&#039;IS&#039;&#039;&#039;--&amp;gt; &#039;&#039;&#039;Work Area&#039;&#039;&#039;--&amp;gt;&#039;&#039;&#039;Switch&#039;&#039;&#039;.&lt;br /&gt;
#Collect blots and save in tin foil with notes in your lab notebook.&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Western_Blotting&amp;diff=1642</id>
		<title>Western Blotting</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Western_Blotting&amp;diff=1642"/>
		<updated>2021-03-26T13:54:04Z</updated>

		<summary type="html">&lt;p&gt;Reddj: removed ECL instructions- JR&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*Irritant&lt;br /&gt;
*Electrophoresis&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Transfer Buffer (200 mL Methanol, 100 mL 10X [[ Transfer Buffer ]] to final 1L volume)&lt;br /&gt;
*Transfer Apparatus, either Bio-Rad or Invitrogen&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
#Turn on heat block to 85 degrees&lt;br /&gt;
#Run SDS-PAGE gel using [[ SDS-PAGE Running Buffer ]] and prepare diluted transfer buffer&lt;br /&gt;
## Use a prepared 4-12% tris gel (in the 4 degree). Remove it from the packaging, remove the white strip of tape from the bottom back, and gently pull the comb out and rinse with water.&lt;br /&gt;
##Load into gel tank. Fill with SDS page Running buffer (1X) to the fill line in the front and halfway up the back&lt;br /&gt;
##Boil sample at 85 degrees for ~3 min&lt;br /&gt;
##Load 3 microliters of protein ladder (purple top) (in the 4 degree), and 10 microliters of each sample into separate wells.&lt;br /&gt;
## Place top on tank, plug into power source and run at 125 Volts until samples and ladder reach the bottom of the gel. (Tip: Gel runs more evenly if you start a lower V and increase once the samples have run down 1/3 of the gel.)&lt;br /&gt;
#Make sandwich (black side, sponge, filter paper, gel, nitrocellulose, filter paper, sponge, clear side), ensuring no bubbles between layers with black piece on bottom and layer as above.  Place in apparatus so that the black sandwich touches the black transfer piece.  Fill with transfer buffer.  &lt;br /&gt;
#Transfer 4h at 75V (in cold room) or overnight at 35V (room temp with an ice pack).&lt;br /&gt;
#Stain for total protein with Revert total protein stain on rocker for 5 minutes --when finished pour total protein stain back in bottle for later use!&lt;br /&gt;
#Rinse twice in revert wash solution (60ml MeOH, 13.4 ml Acetic Acid, 126.6 ml Water)&lt;br /&gt;
#Scan using licor for total protein, which will be used to normalize the blot&lt;br /&gt;
#Rinse nitrocellulose in revert reversal solution for at least 5 and no more than 10 minutes until nitrocellulose appears clear again (.2g NaOH, 60ml MeOH, 140ml Water)&lt;br /&gt;
#Rinse nitrocellulose in 2% BSA (2g BSA in 100ml TBST, stored in fridge) for 1 hour&lt;br /&gt;
#Incubate with primary antibody (check for dilution) in 2% BSA for &amp;gt;1h &lt;br /&gt;
#Wash blot every 5 minutes for 15 min with TBST.&lt;br /&gt;
#Incubate with appropriate secondary antibody (10 000X) for 45min-1h (20 ml 2% BSA 1ul of both secondary antibodies, all found in fridge Ab stocks with blue dots on top)&lt;br /&gt;
#Wash blot every 5 minutes for 15 min with TBST.&lt;br /&gt;
#Rinse once or twice with double distilled water.&lt;br /&gt;
#Scan dry blot using LiCor Odyssey.&lt;br /&gt;
&lt;br /&gt;
==If Using LiCor==&lt;br /&gt;
#Start -&amp;gt; New -&amp;gt; Scan Image -&amp;gt; Login -&amp;gt; Peloquin -&amp;gt; Password Located in Desk -&amp;gt; Select Dimensions -&amp;gt; Start Scan&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category: Western Blotting ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1636</id>
		<title>Nr3c1 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1636"/>
		<updated>2020-11-17T19:00:28Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
nr3c1&lt;br /&gt;
*Fwd: AAACAGGGTTATGCTTGGCA&lt;br /&gt;
*Rev: TGCCTGCTAGGCAAATGATCT&lt;br /&gt;
&lt;br /&gt;
Cre&lt;br /&gt;
*Fwd: GCATT ACCGG GCAAC GAGTG ATGAG&lt;br /&gt;
*Rev: GAGTG AACGA ACCTG GTCGA AATCA GTGCG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Make nr3c1 primer dilution at 1uM (10uL each primer + 980uL water) and Cre at .4uM. Primers in &#039;&#039;&#039;Genotyping Box&#039;&#039;&#039;  are marked with a star.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
&lt;br /&gt;
* 94 °C 2 min &lt;br /&gt;
* 10 cycles of:&lt;br /&gt;
** 94 °C 20 s&lt;br /&gt;
** 65 °C 15 s&lt;br /&gt;
** 68 °C 10 s&lt;br /&gt;
*28 cycles of:&lt;br /&gt;
**94 °C 15 s&lt;br /&gt;
**60 °C 15 s&lt;br /&gt;
**72 °C 10 s&lt;br /&gt;
*72 °C 2 min&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Tamoxifen_Injections_for_Inducible_Knockouts&amp;diff=1634</id>
		<title>Tamoxifen Injections for Inducible Knockouts</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Tamoxifen_Injections_for_Inducible_Knockouts&amp;diff=1634"/>
		<updated>2020-06-08T17:10:47Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
*[[SOP - Needle Capping]]&lt;br /&gt;
*[[SOP- Tamoxifen]]&lt;br /&gt;
&lt;br /&gt;
==METHODS==&lt;br /&gt;
* Make up the tamoxifen in corn oil at 10mg/mL (100 mg in 10mL corn oil)-- must wear nitrile gloves when dealing with tamoxifen.&lt;br /&gt;
** Tamoxifen takes a long time to go into solution so plan to prepare ahead of time.&lt;br /&gt;
* Inject 50 mg/kg on five consecutive days, at the same time each day.  The time is important, otherwise they will overdose if you inject too close together.  &lt;br /&gt;
* To determine how much to inject weigh the mouse and inject 5 uL/g of mouse.  This means a 25 g mouse will get an injection of 125 uL.&lt;br /&gt;
** Give yourself plenty of time to fill needles because the corn oil takes a long time to aspirate--watch for bubbles.&lt;br /&gt;
* Tamoxifen can be stored at room temperature for up to a week.&lt;br /&gt;
* The initial weights can be used for the rest of the week when determining injection volume, unless there is reason to believe they will be changing drastically.&lt;br /&gt;
&lt;br /&gt;
* Notes about transferring mice: &lt;br /&gt;
** Mice must be transferred to the biocontainment room during injections and for an additional 72 hrs post final injection. &lt;br /&gt;
** The husbandry staff need to know a few days prior to transfer so they can have the room ready for occupancy (i.e. everything stocked and agent filled), for this email &#039;&#039;&#039;sanderjo@med.umich.edu&#039;&#039;&#039; to tell him &#039;&#039;&#039;when&#039;&#039;&#039; and &#039;&#039;&#039;how many cages&#039;&#039;&#039; you you plan to transfer. &lt;br /&gt;
** If you are introducing a new chemical or biological hazard, they need to be made aware of this. &lt;br /&gt;
** There are special barcodes for this room so you must change them out when you transfer in and then again change them to the regular ones when transferring back out. &lt;br /&gt;
** Remember to mark the bottom portion of the actual cage with the appropriate sticker (biological or chemical hazard) and place appropriate acetate with required information (name of agent, dates of administration, and dose)---if you are treating the water with a drug the bottle must be marked was well.&lt;br /&gt;
** Make sure to provide animals with food and water.&lt;br /&gt;
** Additional PPE is required and highly monitored in this area, make sure to abide with these regulations!&lt;br /&gt;
&lt;br /&gt;
[[ Category: Tamoxifen]] &lt;br /&gt;
[[ Category: Mouse Work ]]&lt;br /&gt;
[[ Category: Knockout Mouse ]]&lt;br /&gt;
[[ Category: Inducible Knockout Mouse ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=SHROB_Genotyping&amp;diff=1633</id>
		<title>SHROB Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=SHROB_Genotyping&amp;diff=1633"/>
		<updated>2020-06-08T17:09:21Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;__NOTOC__&lt;br /&gt;
==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
&lt;br /&gt;
==New Method==&lt;br /&gt;
This method was a tetra-pair ARMS system designed using the tool at http://primer1.soton.ac.uk/primer1.html&lt;br /&gt;
&lt;br /&gt;
===Primers===&lt;br /&gt;
* SHROB Flanking 5&#039;:  GGTTGTTTCTCAATGCAGATAGTAAATT&lt;br /&gt;
* SHROB Inner Fwd: CCTGGACACTGTCACCTAATGATTAAA&lt;br /&gt;
* SHROB Inner Rev	: TCCATTCAATAACCAGATATAACAGAGTA&lt;br /&gt;
* SHROB Flanking Rev: TAATACTTGTTAACATTCGAAGGGATTC&lt;br /&gt;
&lt;br /&gt;
===Expected Results===&lt;br /&gt;
There are two outer control primers and two inner primers, one of which (the Fwd primer) is specific for the mutation as shown below.  &lt;br /&gt;
&lt;br /&gt;
[[File:SHROB Genotyping.png]]&lt;br /&gt;
&lt;br /&gt;
There should always be a 248bp fragment, and one or both of the other fragments:&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! style=&amp;quot;font-weight: bold;&amp;quot; | Genotype&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; font-weight: bold;&amp;quot; | Bands&lt;br /&gt;
|-&lt;br /&gt;
| Wild-Type&lt;br /&gt;
| 248&lt;br /&gt;
| 184&lt;br /&gt;
| &lt;br /&gt;
|-&lt;br /&gt;
| Mutant&lt;br /&gt;
| 248&lt;br /&gt;
| &lt;br /&gt;
| 118&lt;br /&gt;
|-&lt;br /&gt;
| Heterozygote&lt;br /&gt;
| 248&lt;br /&gt;
| 184&lt;br /&gt;
| 118&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;div class=&amp;quot;toccolours mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
==Original Method==&lt;br /&gt;
This is the older method, suggested by Takaya &#039;&#039;et al.&#039;&#039;&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible-content&amp;quot;&amp;gt;&lt;br /&gt;
===Primers===&lt;br /&gt;
* SHROB-Fwd AGT GAA TGC TGT GCA GTC&lt;br /&gt;
* SHROB-Rev AAG GTT CTT CCA TTC AAT&lt;br /&gt;
&lt;br /&gt;
===Reference===&lt;br /&gt;
From Takaya K, Ogawa Y, Hiraoka J, Hosoda K, Yamori Y, Nakao K, Koletsky RJ. Nonsense mutation of leptin receptor in the obese spontaneously hypertensive Koletsky rat. Nat Genet 14: 130–1, 1996. [10.1038/ng1096-130 doi]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;blockquote&amp;gt;&lt;br /&gt;
Genotyping of lean and obese Koletsky rats by PCR-RFLP analysis. Primers (5 -AGTGAATGCTGTGCAGTC-3 ; 5&#039;-AAGGTTCTTCCATTCAAT-3&#039;) were used to amplify PCR products from 100 ng genomic DNA in a 50 uL reaction. The reaction profiles were as follows; denaturation at 94C for 30 s, annealing at 55C for 30 s, and extension at 72C for 30 s, for 30 cycles, All PCR products were digested with Tru9I, analysed by electrophoresis on a 5.0 % agarose gel (NuSieve 3:1 Agarose, Takara Shuzo Co., Ltd., Shiga, Japan), and stained with ethldium bromide. No Tru9l sites were found in the 121-bp PCR product amplified from genomic DNA derived from a wild-type lean Koletsky rat, and the PCR product was not cleaved with Tru9l (lane 1). A single Tru9l restriction site was present in the mutant allele, and Tru9I digestion of the genomic PCR products from obese Koletsky (fa/fa) rats resulted in two fragments of 82 bp and 39 bp in size (lanes 6-1 0). Tru9l digestion of the PCR products from heterozygous lean Koletsky (+/fa rats gave rise to three 121-bp,82-bp, and 39-bp fragments (lanes 2-5). &lt;br /&gt;
&amp;lt;/blockquote&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:Leptin ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Rapamycin_Injections&amp;diff=1632</id>
		<title>Rapamycin Injections</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Rapamycin_Injections&amp;diff=1632"/>
		<updated>2020-06-08T17:07:52Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
*[[SOP - Needle Capping]]&lt;br /&gt;
*[[SOP - Rapamycin]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Tween 80 - Sigma P1754&lt;br /&gt;
*PEG 400 Liquid - Sigma P3265&lt;br /&gt;
&lt;br /&gt;
==Preparation==&lt;br /&gt;
*Weigh out 2.08g of each Tween 80 and PEG into a 50 mL falcon tube.  Bring up to 40 mL with water and filter by steriflip.  This is 5.2% PEG/Tween&lt;br /&gt;
*Dissolve rapamycin at 20 mg/mL (0.0219 M) in ethanol (prepare as a 1 mL aliquot and store at -20 C).&lt;br /&gt;
*Add 5 uL of 20 mg/mL RAPA in 1 mL Tween 80/PEG diluent to get a 0.1 mg/mL concentration (109 uM; use this for 1 week).&lt;br /&gt;
*IP inject 10 uL/g body weight (1 mg/kg)&lt;br /&gt;
&lt;br /&gt;
==Alternate Rapamycin Injection Regimen==&lt;br /&gt;
* Phenotypes seem to be different with rapamycin as treated by Lamming et al.&lt;br /&gt;
* This protocol is from Lamming et al http://dx.doi.org/10.1126/science.1215135&lt;br /&gt;
&amp;lt;blockquote&amp;gt;&lt;br /&gt;
rapamycin treatment was performed by injecting 8 to 10 week old mice intraperitoneally&lt;br /&gt;
once daily with either 1 mg/kg rapamycin suspended in 0.9% NaCl and 2% ethanol at a&lt;br /&gt;
concentration of 0.5 mg/mL (547 μM), or vehicle only for 14-28 days.&lt;br /&gt;
&amp;lt;/blockquote&amp;gt;&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Perfusion_of_Mouse&amp;diff=1631</id>
		<title>Perfusion of Mouse</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Perfusion_of_Mouse&amp;diff=1631"/>
		<updated>2020-06-08T17:05:10Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
*[[SOP - Animal Anesthetics]]&lt;br /&gt;
*[[SOP - Carcinogens]]&lt;br /&gt;
*[[SOP - Formalin and Paraformaldehyde]]&lt;br /&gt;
*[[SOP - Needle Capping]]&lt;br /&gt;
*[[SOP- Irritants]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*0.9 % Saline solution&lt;br /&gt;
*10% formalin solution&lt;br /&gt;
*Avertin&lt;br /&gt;
*Isofluorane&lt;br /&gt;
*30 gauge needle&lt;br /&gt;
*1 mL syringe&lt;br /&gt;
*Peristaltic pump&lt;br /&gt;
*Collecting dish&lt;br /&gt;
*Surgical stage/platform&lt;br /&gt;
**Make sure this is level with the edge of the collecting dish to allow for the need to rest during the procedure&lt;br /&gt;
===Surgical tools:===&lt;br /&gt;
*Dissecting scissors&lt;br /&gt;
*Forceps&lt;br /&gt;
*Clamp scissors&lt;br /&gt;
*Standard scissors&lt;br /&gt;
&lt;br /&gt;
===Avertin Preparation===&lt;br /&gt;
*Taken from: http://web.jhu.edu/animalcare/rdf/avertin.html&lt;br /&gt;
*Stock Solution (1.6 g/ml)&lt;br /&gt;
**Mix 25 g avertin and 15.5 ml tert-amyl alcohol at room temperture for ~12 hours in a dark bottle.&lt;br /&gt;
**Can store stock solutions at room temperature for one year.&lt;br /&gt;
*Working solution (20 mg/ml)&lt;br /&gt;
**Mix 0.5 ml avertin stock solution and 39.5 ml 0.9% saline in dark/foil covered container.&lt;br /&gt;
**Filter solution through 0.2 micron filter into a dark/foiled covered container.&lt;br /&gt;
**Store solution at 4 degree C.&lt;br /&gt;
**Replace working solution each month.&lt;br /&gt;
*Notes:&lt;br /&gt;
**Avertin is light sensitive.&lt;br /&gt;
**Degradation products are lethal.&lt;br /&gt;
**Always store at 4 degree C&lt;br /&gt;
**Do NOT use a solution that is yellow or contains a precipitate.&lt;br /&gt;
**Avertin is lipid soluble and may require a larger dose in an obese animal.&lt;br /&gt;
&lt;br /&gt;
==Perfusion Pump Set Up==&lt;br /&gt;
*Place needle on end of tubing&lt;br /&gt;
*Insert one tube into 0.9% saline solution, and one tube into 10% formalin solution&lt;br /&gt;
&#039;&#039;Image 1: Set up of the two tube system from 0.9% saline solution and 10% formalin solution.&#039;&#039;&lt;br /&gt;
[[File:perfusionbottle.png]]&lt;br /&gt;
*Turn pump on to a flow rate of 0.72 ml/min&lt;br /&gt;
*Have stopcock turned to allow for flow of saline&lt;br /&gt;
&#039;&#039;Image 2: Stopcock set up to allow for 0.9% saline and 10% formalin solution to flow through to main line.&#039;&#039;&lt;br /&gt;
[[File:perfusionstopcock.png]]&lt;br /&gt;
*Fill line with 0.9% saline until you have a steady stream of 0.9% saline from the end of the needle.&lt;br /&gt;
*Turn off peristaltic pump and turn stopcock to allow for formalin solution to flow&lt;br /&gt;
*Turn on peristaltic pump and pump 10% formalin solution until flow fluid is before the stopcock&lt;br /&gt;
**Flow has not entered the main line&lt;br /&gt;
*Turn off peristaltic pump and turn stopcock to allow for saline to flow&lt;br /&gt;
*Turn on pump and pump saline through the main line at stated flow rate&lt;br /&gt;
&#039;&#039;Image 3: Overview of the entire perfusion setup (excluding the procedural platform in the collecting dish)&#039;&#039;&lt;br /&gt;
[[File:perfusionsetup.png]]&lt;br /&gt;
&lt;br /&gt;
==Animal Procedure==&lt;br /&gt;
*Place mouse in isofluorane chamber and lightly anesthetize the animal.&lt;br /&gt;
*Remove mouse from chamber&lt;br /&gt;
*For mouse anesthesia, administer 0.8 ml/20 g (of mouse body weight) Avertin through intraperitoneal injection with 30 ½ gauge needle.&lt;br /&gt;
*Wait for 3 minutes or until the mouse no longer responds to painful stimuli, such as paw pinch before proceeding.&lt;br /&gt;
*Lay the mouse on its back.&lt;br /&gt;
*Using tweezers and operating/dissecting scissors open up the skin and expose the chest cavity.&lt;br /&gt;
*Cut open the diaphragm using standard scissors.&lt;br /&gt;
**Be careful to not pierce the heart.&lt;br /&gt;
*Using clamp scissors, grab at the base of the sternum, cut through the ribcage and lift to expose the heart.&lt;br /&gt;
*Transfer the mouse to the procedural stage/platform. &lt;br /&gt;
*Insert the 30 gauge needle (from the tubing with saline/10% formalin solution) into the apex of the left ventricle, being careful to keep the tip of the needle in the lumen of the ventricle.&lt;br /&gt;
*Immediately after inserting the needle into the left ventricle, cut the right ventricle using standard scissors.&lt;br /&gt;
**This allows for the blood to flow out of the mouse and drain into collecting dish.&lt;br /&gt;
*Perfuse with saline solution for 10 minutes.&lt;br /&gt;
*After 10 minutes, switch the stopcock to allow for flow of formalin solution, at same flow rate as saline.&lt;br /&gt;
*Perfuse for 10-12 minutes with 10% formalin solution.&lt;br /&gt;
*With the pump still on, remove needle from left ventricle. &lt;br /&gt;
**Mouse is now fixed for tissue collection.&lt;br /&gt;
*When collecting tissues, keep tissues in 10% formalin solution for ~24 hours at 4 degree C.&lt;br /&gt;
*Transfer tissues to PBS after for long-term storage at 4 degree C.&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Paraffin_Embedding_of_Tissue_Samples&amp;diff=1630</id>
		<title>Paraffin Embedding of Tissue Samples</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Paraffin_Embedding_of_Tissue_Samples&amp;diff=1630"/>
		<updated>2020-06-08T17:02:48Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Carcinogens]]&lt;br /&gt;
*[[SOP - Flammables and Combustibles]]&lt;br /&gt;
*[[SOP - Formalin and Paraformaldehyde]]&lt;br /&gt;
*[[SOP- Irritants]]&lt;br /&gt;
&lt;br /&gt;
== Paraffin embedding protocol ==&lt;br /&gt;
#Harvest tissue from animal, place into cassette and submerge in 10% neutral buffered formalin for 24-48 hrs (depending on thickness of sample).&lt;br /&gt;
#Move cassettes into 70% ethanol for 24 hrs. Samples can be left in 70% for long term storage, if required. &lt;br /&gt;
##Note that the subsequent dehydration steps involve many long incubation periods and therefore should be started first thing in the morning (unless you plan on being in the lab overnight!).&lt;br /&gt;
#Turn on wax pots.&lt;br /&gt;
#Move cassettes into 75% ethanol for 30 minutes.&lt;br /&gt;
#Move cassettes into 95% ethanol for 75 minutes. Repeat this step a second time, using fresh 95% ethanol.&lt;br /&gt;
#Move cassettes into 100% ethanol for 60 minutes. Repeat this step twice more, using fresh 100% ethanol each time. &lt;br /&gt;
##Some protocols suggest that the first 100% ethanol wash can be left over night if time is an issue. However, it must be noted that extending the dehydration process can result in alterations to the morphology of your tissue.&lt;br /&gt;
##During these incubation steps, prepare beakers with 58-60 deg C paraffin (the melting point of paraffin is 58 C; many embedding procedures recommend that the paraffin to be 2 C above the melting point for best results).&lt;br /&gt;
#Move cassettes into Citrosolv for 30-60 minutes. Repeat this step a second time, using fresh Citrosolv.&lt;br /&gt;
#Move cassettes into 60 deg C paraffin for 60 minutes. Repeat this step twice more, using fresh paraffin each time. &lt;br /&gt;
##Some protocols suggest that the second paraffin incubation step can be extended over night. However, this may increase the risk of the tissue cracking during sectioning.&lt;br /&gt;
##During these incubation steps, turn on the paraffin wax machine (Link Building, Room 311).&lt;br /&gt;
#Immediately prior to embedding, spray wax mold with &amp;quot;Mold Grease&amp;quot; and coat the bottom layer of the mold with melted paraffin.&lt;br /&gt;
#Take your sample and orient it on top of the base wax as desired. Partially cover with more paraffin. &lt;br /&gt;
#Place pathology cassette on top of the mold and completely fill the mold.&lt;br /&gt;
#Place mold with sample on &amp;quot;Cold Side&amp;quot; of embedding station .&lt;br /&gt;
##The paraffin will solidify in 10-15 minutes.&lt;br /&gt;
#Remove embedded sample from the mold (should just slip out). &lt;br /&gt;
#Store at room temperature until ready to section.&lt;br /&gt;
&lt;br /&gt;
==Wash Solution Table==&lt;br /&gt;
{|style=&amp;quot;border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #000; padding: 0&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!style=&amp;quot;border-style: solid; border-width: 0 1px 1px 0&amp;quot;| Solution&lt;br /&gt;
!style=&amp;quot;border-style: solid; border-width: 0 0 1px 0&amp;quot;| Time&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 70% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| Overnight/24 hours&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 75% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 30 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 95% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 75 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 95% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 75 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 100% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 100% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 100% ethanol&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| Citrosolv&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 30 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| Citrosolv&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 30 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 60 degree paraffin&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 60 degree paraffin&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min&lt;br /&gt;
|-&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0 1px 0 0&amp;quot;| 60 degree paraffin&lt;br /&gt;
|style=&amp;quot;border-style: solid; border-width: 0&amp;quot;| 60 min or O/N&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1629</id>
		<title>PCR Analysis of Tail DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1629"/>
		<updated>2020-06-08T17:00:55Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;see [[Genotyping Program]] for strain specific details&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
# Dream Taq Green master mix&lt;br /&gt;
# Specific gene Primers (0.4um Working stock)&lt;br /&gt;
# Tail digest DNA&lt;br /&gt;
# ddH2O&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
First, make 250ul of 0.4um working stock primers from 100um Primary Stocks.&lt;br /&gt;
#248 ul ddH20&lt;br /&gt;
#1ul forward primer (100um)&lt;br /&gt;
#1ul reverse primer (100um)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Use the following Volumes per 25ul Reaction:&lt;br /&gt;
&lt;br /&gt;
Per sample (1X)&lt;br /&gt;
#Dream Tag Master mix: 12.5uL (&amp;quot;Molecular Biology Stuff&amp;quot; box in freezer) &lt;br /&gt;
#0.4um Primer Mix: 5ul&lt;br /&gt;
#Sterile ddH2O: 7.5ul &lt;br /&gt;
&lt;br /&gt;
*Template: 1 uL&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Run &amp;quot;specfic&amp;quot; PCR Program for gene of interest (approx 2 hours).&lt;br /&gt;
&lt;br /&gt;
*[[Genotyping Program]]&lt;br /&gt;
*[[PCR Amplification of DNA]]&lt;br /&gt;
&lt;br /&gt;
see [[Preparing an Agarose Gel]] for details on preparing a DNA gel&lt;br /&gt;
&lt;br /&gt;
[[Category: Genotyping]]&lt;br /&gt;
[[Category: Mouse Work]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1628</id>
		<title>PCR Analysis of Tail DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1628"/>
		<updated>2020-06-08T17:00:38Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;see [[Genotyping Program]] for strain specific details&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
# Dream Taq Green master mix&lt;br /&gt;
# Specific gene Primers (0.4um Working stock)&lt;br /&gt;
# Tail digest DNA&lt;br /&gt;
# ddH2O&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
First, make 250ul of 0.4um working stock primers from 100um Primary Stocks.&lt;br /&gt;
#248 ul ddH20&lt;br /&gt;
#1ul forward primer (100um)&lt;br /&gt;
#1ul reverse primer (100um)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Use the following Volumes per 25ul Reaction:&lt;br /&gt;
&lt;br /&gt;
Per sample (1X)&lt;br /&gt;
#Dream Tag Master mix: 12.5uL (&amp;quot;Molecular Biology Stuff&amp;quot; box in freezer) &lt;br /&gt;
#0.4um Primer Mix: 5ul&lt;br /&gt;
#Sterile ddH2O: 7.5ul &lt;br /&gt;
&lt;br /&gt;
*Template: 1 uL&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Run &amp;quot;specfic&amp;quot; PCR Program for gene of interest (approx 2 hours).&lt;br /&gt;
&lt;br /&gt;
[[Genotyping Program]]&lt;br /&gt;
[[PCR Amplification of DNA]]&lt;br /&gt;
&lt;br /&gt;
see [[Preparing an Agarose Gel]] for details on preparing a DNA gel&lt;br /&gt;
&lt;br /&gt;
[[Category: Genotyping]]&lt;br /&gt;
[[Category: Mouse Work]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1627</id>
		<title>PCR Analysis of Tail DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Analysis_of_Tail_DNA&amp;diff=1627"/>
		<updated>2020-06-08T16:59:20Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;see [[Genotyping Program]] for strain specific details&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
# Dream Taq Green master mix&lt;br /&gt;
# Specific gene Primers (0.4um Working stock)&lt;br /&gt;
# Tail digest DNA&lt;br /&gt;
# ddH2O&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
First, make 250ul of 0.4um working stock primers from 100um Primary Stocks.&lt;br /&gt;
#248 ul ddH20&lt;br /&gt;
#1ul forward primer (100um)&lt;br /&gt;
#1ul reverse primer (100um)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Use the following Volumes per 25ul Reaction:&lt;br /&gt;
&lt;br /&gt;
Per sample (1X)&lt;br /&gt;
#Dream Tag Master mix: 12.5uL (&amp;quot;Molecular Biology Stuff&amp;quot; box in freezer) &lt;br /&gt;
#0.4um Primer Mix: 5ul&lt;br /&gt;
#Sterile ddH2O: 7.5ul &lt;br /&gt;
&lt;br /&gt;
*Template: 1 uL&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Run &amp;quot;specfic&amp;quot; PCR Program for gene of interest (approx 2 hours).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
see [[Preparing an Agarose Gel]] for details on preparing a DNA gel&lt;br /&gt;
&lt;br /&gt;
[[Category: Genotyping]]&lt;br /&gt;
[[Category: Mouse Work]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1626</id>
		<title>PCR Amplification of DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1626"/>
		<updated>2020-06-08T16:57:11Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Electrophoresis]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Primers – order from IDT prediluted to 100 mM in TE.  Make working solution of 0.4uM-1 uM (100x) in water with both sense and antisense primers combined (300uL water, 3uL of each primer)&lt;br /&gt;
*DreamTaq Green PCR Master mix - contains dNTPs, polymerase, salts, and buffer with loading dye  https://www.thermofisher.com/order/catalog/product/K1081?ICID=search-product#/K1081?ICID=search-product &lt;br /&gt;
*RNAse-Free water - comes in DreamTaq kit&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
*Use the following volumes per reaction&lt;br /&gt;
::*12.5 uL DreamTaq&lt;br /&gt;
::*7.5 uL RNAse-Free water&lt;br /&gt;
::*5.0 uL Working stock Primer (of 0.4-1uM stock solution in water (both primers combined))&lt;br /&gt;
&lt;br /&gt;
==PCR Program==&lt;br /&gt;
*For animals: use programs denoted in [[Genotyping Program]]&lt;br /&gt;
&lt;br /&gt;
*Run PCR Program (approx 3.5 to 4 hours).  Normally use touchdown PCR (&#039;&#039;&#039;DAVETD&#039;&#039;&#039;) as follows:&lt;br /&gt;
:#1 min at 94&lt;br /&gt;
:#30s at 65&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 63 then -0.5/cycle&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#Repeat steps 4-6 28 times&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 45&lt;br /&gt;
:#11 min at 72&lt;br /&gt;
:#Hold at 4 until ready&lt;br /&gt;
*Purify PCR product if necessary using Qiagen kit (Add 5x PB)&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1625</id>
		<title>PCR Amplification of DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1625"/>
		<updated>2020-06-08T16:56:49Z</updated>

		<summary type="html">&lt;p&gt;Reddj: updated&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Electrophoresis]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Primers – order from IDT prediluted to 100 mM in TE.  Make working solution of 0.4uM-1 uM (100x) in water with both sense and antisense primers combined (300uL water, 3uL of each primer)&lt;br /&gt;
*DreamTaq Green PCR Master mix - contains dNTPs, polymerase, salts, and buffer with loading dye  https://www.thermofisher.com/order/catalog/product/K1081?ICID=search-product#/K1081?ICID=search-product &lt;br /&gt;
*RNAse-Free water - comes in DreamTaq kit&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
*Use the following volumes per reaction&lt;br /&gt;
::*12.5 uL DreamTaq&lt;br /&gt;
::*7.5 uL RNAse-Free water&lt;br /&gt;
::*5.0 uL Working stock Primer (of 0.4-1uM stock solution in water (both primers combined))&lt;br /&gt;
&lt;br /&gt;
==PCR Program==&lt;br /&gt;
*For animals: use program denoted in [[Genotyping Program]]&lt;br /&gt;
&lt;br /&gt;
*Run PCR Program (approx 3.5 to 4 hours).  Normally use touchdown PCR (&#039;&#039;&#039;DAVETD&#039;&#039;&#039;) as follows:&lt;br /&gt;
:#1 min at 94&lt;br /&gt;
:#30s at 65&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 63 then -0.5/cycle&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#Repeat steps 4-6 28 times&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 45&lt;br /&gt;
:#11 min at 72&lt;br /&gt;
:#Hold at 4 until ready&lt;br /&gt;
*Purify PCR product if necessary using Qiagen kit (Add 5x PB)&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1624</id>
		<title>PCR Amplification of DNA</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PCR_Amplification_of_DNA&amp;diff=1624"/>
		<updated>2020-06-08T16:49:40Z</updated>

		<summary type="html">&lt;p&gt;Reddj: updated&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Electrophoresis]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
*Primers – order from IDT prediluted to 100 mM in TE.  Make working solution of 0.4uM-1 uM (100x) in water with both sense and antisense primers combined (300uL water, 3uL of each primer)&lt;br /&gt;
*DreamTaq Green PCR Master mix - contains dNTPs, polymerase, salts, and buffer with loading dye  https://www.thermofisher.com/order/catalog/product/K1081?ICID=search-product#/K1081?ICID=search-product &lt;br /&gt;
*RNAse-Free water - comes in DreamTaq kit&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
*Use the following volumes per reaction&lt;br /&gt;
::*Buffer, 5 uL of 10X buffer (Dave&#039;s fridge)&lt;br /&gt;
::*Primers, 10uL of 1uM stock solution in water (both primers combined)&lt;br /&gt;
::*dNTPs, 5uL of 2 mM (&amp;quot;molecular biology stuff&amp;quot; box in freezer)&lt;br /&gt;
::*Sterile water, 28 uL&lt;br /&gt;
::*Template 1 uL&lt;br /&gt;
::*Polymerase 1 uL (turbo pfu found in &amp;quot;enzymes&amp;quot; box in freezer)&lt;br /&gt;
&lt;br /&gt;
*Run PCR Program (approx 3.5 to 4 hours).  Normally use touchdown PCR (&#039;&#039;&#039;DAVETD&#039;&#039;&#039;) as follows:&lt;br /&gt;
:#1 min at 94&lt;br /&gt;
:#30s at 65&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 63 then -0.5/cycle&lt;br /&gt;
:#2 min/kb at 72&lt;br /&gt;
:#Repeat steps 4-6 28 times&lt;br /&gt;
:#30s at 94&lt;br /&gt;
:#30s at 45&lt;br /&gt;
:#11 min at 72&lt;br /&gt;
:#Hold at 4 until ready&lt;br /&gt;
*Purify PCR product if necessary using Qiagen kit (Add 5x PB)&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=PAS_Staining&amp;diff=1623</id>
		<title>PAS Staining</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=PAS_Staining&amp;diff=1623"/>
		<updated>2020-06-08T15:34:32Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Flammables and Combustibles]]&lt;br /&gt;
*[[SOP- Irritants]]&lt;br /&gt;
&lt;br /&gt;
[[ Category: Immunohistochemistry ]]&lt;br /&gt;
&lt;br /&gt;
This protocol is modified from http://www.ihcworld.com/_protocols/special_stains/pas_diastase_ellis.htm&lt;br /&gt;
&lt;br /&gt;
==Principl3==&lt;br /&gt;
Alpha-amylase, also known as diastase, is an enzyme commonly present in saliva.  The action is to cleave the a-glucosidic 1,4 linkages of starch or glycogen to yield water soluble sugars (maltose) and dextrins.  These water soluble sugars are then washed from the section.&lt;br /&gt;
 &lt;br /&gt;
Periodic acid (HIO4) solutions oxidise 1,2-glycol groups 2(H-C-OH), producing a dialdehyde, 2(R-CHO). By treating with a pale straw coloured solution of leuco fuchsin (Schiff&#039;s reagent), the resultant dialdehyde is demonstrated by the colour precipitation of an insoluble magenta coloured complex (aldehyde fuchsin).&lt;br /&gt;
 &lt;br /&gt;
Technical Points&lt;br /&gt;
 &lt;br /&gt;
1.   Not critical, however fixation by aldehyde addition, eg glutaraldehyde, will produce non-specific general PAS positivity.&lt;br /&gt;
2.   (step 2) - glycogen is removed from the visualisation by pre-treating the section with amylase.&lt;br /&gt;
3.   (step 6) - Schiff&#039;s reagent deteriorates rapidly if not kept in a closed container.  When a pinkish discolouration appears, discard the reagent.&lt;br /&gt;
4.   (step 7) - Washing not only removes any excess reagent from the section, but also promotes the development of the rich magenta colour.  Too gentle washing will result in a strong artefactual red stained background due to the action of the powerful dye basic fuchsin, formed from the destabilisation of the leuco fuchsin by loss of sulphurous acid to the watery environment.&lt;br /&gt;
5.   (step 11) - Over differentiation can lead to the eventual decolourisation of PAS positive material.&lt;br /&gt;
Method&lt;br /&gt;
 &lt;br /&gt;
1.   Bring sections to distilled water. Note: Omit steps 2 and 3 for PAS stain only&lt;br /&gt;
2.   Treat sections with amylase solution 20 mins&lt;br /&gt;
3.   Wash well in running tap water&lt;br /&gt;
4.   Treat with periodic acid     .5 mins&lt;br /&gt;
5.   Wash well in distilled water&lt;br /&gt;
6.   Stain with Schiff&#039;s reagent 10 mins&lt;br /&gt;
7.   Wash in fast running tap water 3-5 mins&lt;br /&gt;
8.   Stain nuclei with haematoxylin 1 min&lt;br /&gt;
9.   Rinse in running tap water&lt;br /&gt;
10. Differentiate with acid alcohol&lt;br /&gt;
11. Wash in running tap water&lt;br /&gt;
12. Blue nuclei in Scott’s&lt;br /&gt;
13. Rinse in running tap water&lt;br /&gt;
14. Dehydrate, clear and mount.&lt;br /&gt;
 &lt;br /&gt;
Results&lt;br /&gt;
 &lt;br /&gt;
                        PAS positive materials....................magenta&lt;br /&gt;
                        nuclei........................................blue&lt;br /&gt;
                        erythrocytes................................pale pink&lt;br /&gt;
 &lt;br /&gt;
Glycogen is removed by diastase/amylase and is therefore unstained in a PASD&lt;br /&gt;
 &lt;br /&gt;
          Find Images&lt;br /&gt;
 &lt;br /&gt;
Reagent Formulae&lt;br /&gt;
 &lt;br /&gt;
1.  Diastase solution 0.5%&lt;br /&gt;
      a-amylase         0.25g&lt;br /&gt;
      distilled water   50.0ml&lt;br /&gt;
Dissolve the enzyme in the water with gentle shaking.  Prepare fresh.&lt;br /&gt;
a-amylase preferred is Sigma a-amylase type VI-B, product number A3176.  The Sigma preparation is stated to be extracted from porcine pancreas.&lt;br /&gt;
 &lt;br /&gt;
2.  Periodic acid 0.5%&lt;br /&gt;
            Periodic acid      2.5g&lt;br /&gt;
            Distilled water    500 ml&lt;br /&gt;
Store refrigerated&lt;br /&gt;
 &lt;br /&gt;
3.  Schiff&#039;s reagent&lt;br /&gt;
 a)  basic fuchsin dye (CI 42500)        6.0 g&lt;br /&gt;
      distilled water                            1200.0 ml&lt;br /&gt;
      N hydrochloric acid                     60.0 ml&lt;br /&gt;
      sodium metabisulphite               12.0 g&lt;br /&gt;
&lt;br /&gt;
Dissolve 6 g basic uchsin in 600ml of distilled water. Bring to the boil and allow to boil for a few minutes. Cool to 50°C and add 60 ml N HCl.  Cool further to 25°C and add 12g sodium metabisulphite (Analar).&lt;br /&gt;
Allow the solution to stand and bleach for 24 hours in the dark.&lt;br /&gt;
&amp;amp; &lt;br /&gt;
After 24 hours add 5 to 6 g of activated decolourising charcoal and shake for approximately one minute.&lt;br /&gt;
 &lt;br /&gt;
Filter rapidly through coarse filter paper.  The solution should be clear.  If it possesses colour then repeat the charcoal step./font&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
Finally add 600 ml of distilled water. Store in a dark bottle in the fridge.&lt;br /&gt;
 &lt;br /&gt;
b)  Pre-prepared Schiff’s reagent - Australian Biostain Pty Ltd,PO Box 1407,Traralgon, VIC.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Sigma-Aldrich Protocol==&lt;br /&gt;
&lt;br /&gt;
*Using PAS Staining System: 395B-1KT&lt;br /&gt;
&lt;br /&gt;
#Deparaffinze and hydrate sections to deionized water.&lt;br /&gt;
#Immerse slides in &#039;&#039;&#039;Periodic Acid Solution&#039;&#039;&#039; for 5 minutes at room temperature (18-26C).&lt;br /&gt;
#Rinse slide in several changes of distilled water.&lt;br /&gt;
#Immerse slides in &#039;&#039;&#039;Schiff&#039;s Reagent&#039;&#039;&#039; for 15 minutes at room temperature (18-26C).&lt;br /&gt;
#Wash slides in running tap water for 5 minutes.&lt;br /&gt;
#Counterstain slides in &#039;&#039;&#039;Hematoxylin Solution&#039;&#039;&#039;, Gill No. 3, for 90 seconds.&lt;br /&gt;
#Rinse slides in running tap water.&lt;br /&gt;
#Dehydrate, clear, and mount sections in toluene or xylene based mounting media.&lt;br /&gt;
&lt;br /&gt;
https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/General_Information/2/395.pdf&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Osmotic_Minipump_Implantation&amp;diff=1622</id>
		<title>Osmotic Minipump Implantation</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Osmotic_Minipump_Implantation&amp;diff=1622"/>
		<updated>2020-06-08T15:32:25Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
*[[SOP - Animal Anesthetics]]&lt;br /&gt;
&lt;br /&gt;
This page is a repository of resources for using the ALZET osmotic minipump.&lt;br /&gt;
&lt;br /&gt;
Before selecting a pump or planning an experiment all users should first  explore the pages under the &amp;quot;http://www.alzet.com products&amp;gt;Guide to Use&amp;quot;] dropdown menus with particular attention to the following pages to assure appropriate selection and application of a pump for an experimental study: &lt;br /&gt;
&lt;br /&gt;
*[https://www.alzet.com/guide-to-use/checklist-and-tips-for-successful-use-of-alzet-osmotic-pumps/ Manufacturer’s comprehensive checklist]&lt;br /&gt;
*[https://www.alzet.com/resources/alzet-technical-tips/ Technical Tips]&lt;br /&gt;
*[https://www.alzet.com/alzaid-chemical-compatibility-test-kit/ Chemical compatibility]&lt;br /&gt;
*[https://www.alzet.com/guide-to-use/implementation_and_explanation/ Minipump implantation Suggestions]&lt;br /&gt;
*[https://www.alzet.com/guide-to-use/implementation_and_explanation/ Surgical instruction manual]&lt;br /&gt;
*[https://vimeopro.com/user38667762/alzet-resource-videos ALZET resources Vimeo channel]&lt;br /&gt;
*https://www.alzet.com/products/alzet_pumps/specifications/ ALZET Product Rate and Durations Specifications]&lt;br /&gt;
*[https://www.alzet.com/guide-to-use/filling-priming-alzet-pumps/ Pump Filling and Priming Instructions]&lt;br /&gt;
*[https://www.alzet.com/guide-to-use/mri/ Use of osmotic pumps with MRI] &lt;br /&gt;
*[https://www.alzet.com/formulating-the-solution/ Concentration calculator]&lt;br /&gt;
&lt;br /&gt;
For details on study design considerations (protocols, timeline, power calculations, etc.) as developed in pilot leptin infusion experiments, [https://docs.google.com/presentation/d/15R6rhEefvqhxJfwDy019DONKbSbp6x27wdQf4gyGYsA/edit?usp=sharing pleaser refer to this shared slide deck]. &lt;br /&gt;
&lt;br /&gt;
For additional resources, you may refer to [https://drive.google.com/open?id=1wubhf3yG4VY4SiBqLbfKmm8myrwXt_Ts this shared google drive folder]. &lt;br /&gt;
&lt;br /&gt;
Consider setting up a consultation with ULAM veterinary services for a demonstration and practice before performing your own surgery.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Pre-surgery checklist:&lt;br /&gt;
&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
☐	Stack of paper towels, gauze, q-tips&lt;br /&gt;
&lt;br /&gt;
☐	Heating pad&lt;br /&gt;
&lt;br /&gt;
☐	Sterile forceps (x2)&lt;br /&gt;
&lt;br /&gt;
☐	Hemostat&lt;br /&gt;
&lt;br /&gt;
☐	Incisors&lt;br /&gt;
&lt;br /&gt;
☐	Wound clips &lt;br /&gt;
&lt;br /&gt;
☐	Wound clip applicator and wound clip remover&lt;br /&gt;
&lt;br /&gt;
☐	Electric razor (alternately: Nair)&lt;br /&gt;
&lt;br /&gt;
☐	Lint roller &lt;br /&gt;
&lt;br /&gt;
☐	Isoflurane pump&lt;br /&gt;
&lt;br /&gt;
☐	Eye lubricant&lt;br /&gt;
&lt;br /&gt;
☐	Surgery wash and rinse&lt;br /&gt;
&lt;br /&gt;
☐	ALZET osmotic pumps, filled and primed ahead of time&lt;br /&gt;
&lt;br /&gt;
☐	Post-operative analgesic (ie carprofen)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Helpful Tips&#039;&#039;&#039;&lt;br /&gt;
*&#039;&#039;&#039;The ALZET customer support team is EXTREMELY helpful if you are experiencing issues.&#039;&#039;&#039; [mailto:alzet@durect.com alzet@durect.com] or 800-692-2990&lt;br /&gt;
*Use of a sterile filter may not be necessary when using extremely pure solutes so long as you utilize otherwise aseptic technique. This minimizes waste of costly solutes.&lt;br /&gt;
*When using the smaller pump sizes, special considerations for MRI may be disregarded.&lt;br /&gt;
*When filling the pumps, the syringe needle needs to be a fraction of a millimeter smaller than the hole in the pump in which it is inserted.  This means that you will likely have better success using an &#039;&#039;&#039;insulin syringe&#039;&#039;&#039;, which, owing to its small gauge, allows displaced air to escape when filling.&lt;br /&gt;
*Here are some ULAM Surgery guidelines [https://azanimal.sites.uofmhosting.net/node/58 Guidelines on Administration of Substances to Laboratory Animals] and [https://az.research.umich.edu/animalcare/guidelines/guidelines-performance-surgery-rodents ULAM Anesthesia and Analgesia Guidelines]&lt;br /&gt;
*Document the rodent surgery recovery with [https://azanimal.sites.uofmhosting.net/node/36 Rodent Surgery Record] and [https://azanimal.sites.uofmhosting.net/node/36 Cage Card Form Rodent Surgical Record].&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=NADH_NBT_Staining&amp;diff=1621</id>
		<title>NADH NBT Staining</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=NADH_NBT_Staining&amp;diff=1621"/>
		<updated>2020-06-08T15:29:50Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Flammables and Combustibles]]&lt;br /&gt;
*[[SOP- Irritants]]&lt;br /&gt;
&lt;br /&gt;
== Tris Buffer .2M pH 7.4 ==&lt;br /&gt;
#Warm Tris buffer to 37°C in water bath.&lt;br /&gt;
#Use hot plate to keep the buffer at 37°C, pH the buffer with HCl. (pH changes with temperature)&lt;br /&gt;
&lt;br /&gt;
==Methods==&lt;br /&gt;
#20mg NBT aka Nitrotetrazolium Blue Chloride or Nitro Blue Tetrazolium&lt;br /&gt;
#80mg of NADH aka β-Nicotinamide adenine dinucleotide, reduced disodium salt hydrate&lt;br /&gt;
#100mL of Tris Buffer&lt;br /&gt;
#100mL fits in a staining dumpster&lt;br /&gt;
#Incubate for 30 minutes at 37°C&lt;br /&gt;
&lt;br /&gt;
== Dehydrate and coverslip ==&lt;br /&gt;
#Rinse 3-4 times under running DI water&lt;br /&gt;
#Immerse in 50% ethanol for 2x 30 seconds&lt;br /&gt;
#Immerse in 70% ethanol for 2x 30 seconds&lt;br /&gt;
#Immerse in in 95% ethanol for 2x 30 seconds&lt;br /&gt;
#Immerse in in 100% ethanol for 2x 30 seconds&lt;br /&gt;
#Immerse in 1:1 xylene ethanol for 2 minutes for 2x 30 seconds&lt;br /&gt;
#Repeat twice more using fresh xylene. Check staining under the microscope&lt;br /&gt;
#Coverslip using Permount&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Making_LB_Agar_Plates&amp;diff=1620</id>
		<title>Making LB Agar Plates</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Making_LB_Agar_Plates&amp;diff=1620"/>
		<updated>2020-06-08T15:28:03Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP- Autoclave]]&lt;br /&gt;
&lt;br /&gt;
==Materials==&lt;br /&gt;
* Petri Dishes&lt;br /&gt;
* Bacto Agar (BD 214010)&lt;br /&gt;
* LB Broth (Sigma L3522)&lt;br /&gt;
* Antibiotic, usually at 1000X, add 1 uL/mL of media&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
* 500 mL makes about one sleeve of petri dishes&lt;br /&gt;
* Add 25g LB Broth per Liter to an appropriately sized beaker&lt;br /&gt;
* Add Water and Stir until clumps are gone&lt;br /&gt;
* Add 15 g Agar per Liter , this will not dissolve&lt;br /&gt;
* Transfer to a erlenmeyer flask at least 2x the volume that you are making&lt;br /&gt;
* Autoclave for at least a 20 minute liquid cycle&lt;br /&gt;
* Once the liquid is cool to the touch (dosent burn your hand to hold) add antibiotic and mix by swirling&lt;br /&gt;
* Pour into plates, covering the surface and avoiding bubbles&lt;br /&gt;
* Burn off bubbles with bunsen burner or pop with a sterile tip&lt;br /&gt;
* Let plates cool with the lids ajar&lt;br /&gt;
* Invert plates, place in sleeve and mark sleeve as LB/Amp or LB/Km depending on the antibiotic&lt;br /&gt;
&lt;br /&gt;
[[ Category: Cloning ]]&lt;br /&gt;
[[ Category: Media ]]&lt;br /&gt;
[[ Category: Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Insulin_Tolerance_Test&amp;diff=1619</id>
		<title>Insulin Tolerance Test</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Insulin_Tolerance_Test&amp;diff=1619"/>
		<updated>2020-06-08T15:25:26Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPS&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
*[[SOP - Needle Capping]]&lt;br /&gt;
&lt;br /&gt;
==Materials (Bring to Room)==&lt;br /&gt;
*Glucometer - AccuChek Advantage&lt;br /&gt;
*Glucose Test Strips - AccuChek Comfort Curve or equivalent&lt;br /&gt;
*Scale&lt;br /&gt;
*Beaker for weighing mice&lt;br /&gt;
*echoMRI if the mice differ in body fat levels (see below)&lt;br /&gt;
*Syringes&lt;br /&gt;
*0.1 U/mL humulin in PBS (make as 10uL of 100 U/mL in 10 mL, sterile filtered). This will correspond to 1 U/kg injections.  If you are using a higher or lower dose of insulin, add more or less to the 10 mL of PBS, so that injections are 10 uL/g of mass.&lt;br /&gt;
**This may need to be adjusted depending on the insulin sensitivity of the mice, and this is based on a normal C57BL/6J mouse on chow.  &lt;br /&gt;
**In general for insulin resistant mice, such as those &amp;gt;40g on a high fat diet or such, increase the dose to 2 or 2.5U/kg. &lt;br /&gt;
** In general you want the insulin to decrease blood glucose by about 60-70% in the most responsive of your too group so if your response is &amp;lt;20% of &amp;gt;70% change in blood glucose you will probably have to change your dose and retry.  &lt;br /&gt;
**The insulin is diluted from Humulin R-100 and is purchased through the veterinary staff.&lt;br /&gt;
*Timer&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
*Remove food from mice for about 6h by putting them in a fresh cage. Add do not feed tag to cages, or ideally move cage to procedure room.  Try to make sure that the mice are in a quiet, undisturbed temperature controlled room with the lights on.&lt;br /&gt;
*Typically starve the mice at 8AM and aim to start injections at 2PM&lt;br /&gt;
*Prepare a 1 g/10mL solution of glucose in case some animals become hypoglyemic.&lt;br /&gt;
*Weigh mice, mark tails if necessary with different colors for rapid identification and take fasting glucose measurement via a tail clip.&lt;br /&gt;
*Prepare insulin syringes with 10 uL per g mouse weight (ie for a 30g mouse, 300 uL).&lt;br /&gt;
*At approximately 1 min intervals, inject appropriate amount of insulin into interperitoneal cavity of the mouse.&lt;br /&gt;
**Immobilize mouse and restrain tail with one hand&lt;br /&gt;
**Aim needle between the midline and the hip bone&lt;br /&gt;
**Insert syringe (do not inject) into cavity&lt;br /&gt;
**Eject syringe.&lt;br /&gt;
*At desired intervals (normally 15, 30, 45, 60, 75, 90, 105 and 120 min), take blood glucose measurements from tail vein.  If needed re-snip the tail vein.   When measuring glucose just lift the tail of the mouse, while leaving it in the cage, rather than removing and restraining the mouse, which can be more stressful.  &lt;br /&gt;
**If blood glucose drops below 10 mg/dL, or the animal appears catatonic, inject 300 uL of the glucose solution prepared above to rescue the mice and prevent hypoglycmic shock.  Ignore the data from this mouse from that point on.&lt;br /&gt;
*Analyze data by both % change from fasting glucose and absolute values.  Our preferred outcome is to report fasting glucose levels and report percent change as a figure&lt;br /&gt;
*The preferred statistical model is a mixed linear model using the time points as ordinate values and testing for a main effect or an interaction of the treatment/genotype.  Use the R [https://cran.r-project.org/web/packages/lme4/lme4.pdf lme4] package for this.&lt;br /&gt;
&lt;br /&gt;
===Taking into Account Differences in Fat Mass===&lt;br /&gt;
Since most glucose is taken up into non-fat tissues, it can be confounding if you dose based on total body weight, and the two groups differ greatly with respect to the amount of fat mass.  A fat mouse and a lean mouse are likely to have very similar fat-free masses, and by giving more insulin to the fatter animal (because body weight is higher) you might make the fatter mouse seem more insulin sensitive, but really its just responding to a larger amount of insulin.  In these cases the preferred practice is to &#039;&#039;&#039;measure fat free mass by echoMRI&#039;&#039;&#039;, and then dose animals at approximately 1 U/kg of lean mass for a lean animal or 2.5 U/kg of lean mass for an obese animal.&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=H%26E_Staining&amp;diff=1618</id>
		<title>H&amp;E Staining</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=H%26E_Staining&amp;diff=1618"/>
		<updated>2020-06-08T15:23:18Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOPs&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Flammables and Combustibles]]&lt;br /&gt;
*[[SOP- Irritants]]&lt;br /&gt;
*[[SOP- Corrosives]]&lt;br /&gt;
&lt;br /&gt;
== Rehydrate tissue sections ==&lt;br /&gt;
#After cutting sections of tissue onto glass slides, de-pariffinize the tissue sections in xylene for 3 min. Repeat for a total of 3x 3 minute washes using fresh xylene each time&lt;br /&gt;
#Rehydrate the tissue sections by immersing in 100% ethanol for 3 minutes. Repeat a second time using fresh 100% ethanol&lt;br /&gt;
#Immerse sections in 95% ethanol for 3 minutes. Repeat a second time using fresh 95% ethanol&lt;br /&gt;
#Immerse sections in 70% ethanol for 3 minutes&lt;br /&gt;
#Rinse sections 2 to 3 times in distilled water&lt;br /&gt;
&lt;br /&gt;
== Stain tissue sections with haematoxylin ==&lt;br /&gt;
#Immerse sections in pre-prepared Mayer&#039;s haematoxylin for 5 minutes &lt;br /&gt;
#Rinse under running tap water (slides still in box) until water is clear. This will take about 5 minutes&lt;br /&gt;
&lt;br /&gt;
== Stain tissue sections with eosin, dehydrate and coverslip ==&lt;br /&gt;
#Immerse sections in 1% eosin from 15 seconds to 1 minute&lt;br /&gt;
#Rinse 3-4 times under running tap water&lt;br /&gt;
#Immerse in 70% ethanol for 2 minutes&lt;br /&gt;
#Immerse in in 95% ethanol for 2 minutes. Repeat a second time using fresh 95% ethanol&lt;br /&gt;
#Immerse in in 100% ethanol for 2 minutes. Repeat twice more using fresh 100% ethanol&lt;br /&gt;
#Immerse in xylene for 2 minutes. Repeat twice more using fresh xylene. Check staining under the microscope&lt;br /&gt;
#Coverslip using Permount or other xylene-based mounting medium&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Glucose_Tolerance_Test&amp;diff=1617</id>
		<title>Glucose Tolerance Test</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Glucose_Tolerance_Test&amp;diff=1617"/>
		<updated>2020-06-08T15:05:17Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added SOP&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==SOP==&lt;br /&gt;
*[[SOP - Needle Capping]]&lt;br /&gt;
*[[Safety and Animal Training]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Materials (Bring Downstairs)==&lt;br /&gt;
*Glucometer - AccuChek Advantage&lt;br /&gt;
*Glucose Test Strips - AccuChek Comfort Curve.  Order these through Materiels Service by calling 936-6077 and ordering product 2535.  For information see [[https://www31.med.umich.edu/materielsvcs/catalog/details.cfm?stock=2535 here]]. collect in university hospital building, floor B2 in room B2F408 dock 5 across from central pharmacy. &lt;br /&gt;
*Scale&lt;br /&gt;
*Beaker for weighing mice&lt;br /&gt;
*Syringes&lt;br /&gt;
*10% Glucose in PBS (make as 1g in 10 mL, sterile filtered).  This will correspond to 1g/kg glucose injections.&lt;br /&gt;
*Timer&lt;br /&gt;
&lt;br /&gt;
==Protocol==&lt;br /&gt;
#Remove food from mice for about 6h.  Add do not feed tag to cages.&lt;br /&gt;
#Bring mice to procedure room. Put water bottle on cage.&lt;br /&gt;
#Weigh mice, mark tails as necessary and take fasting glucose measurement.  If necessary also take blood for [[Measuring Fasting Insulin]] by filling a heparinized capilary about 2/3 full with blood.&lt;br /&gt;
#Prepare glucose syringes with 10 uL per g mouse weight (ie for a 30g mouse, 300 uL).&lt;br /&gt;
#At 1 min intervals, inject appropriate amount of glucose into interperitoneal cavity of the mouse.&lt;br /&gt;
##Immobilize mouse and restrain tail with one hand&lt;br /&gt;
##Aim needle between the midline and the hip bone&lt;br /&gt;
##Insert syringe (do not inject) into cavity&lt;br /&gt;
##Pull up syringe and ensure that only air is aspirated.  If urine or blood appears in the syringe, start over&lt;br /&gt;
##Eject syringe.&lt;br /&gt;
#At desired intervals (normally 15, 30, 45, 60, 75, 90 and 120 min), take blood glucose measurements from tail vein&lt;br /&gt;
&lt;br /&gt;
[[Category:Mouse Work]]&lt;br /&gt;
[[Category:Glucose Homeostasis]]&lt;br /&gt;
[[Category:Injections]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1616</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1616"/>
		<updated>2020-06-08T15:00:16Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Strain(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || aTSC, mTSC, Placenta TSC || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || aTSC, mTSC, Adipo-Raptor, Adipo-GR-KO, Placenta TSC, Placenta GR || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]|| || || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || || || &lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || GR-KO and Adipo-GR-KO || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || mc4r || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || ppp1r3c (PTG) || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1= KO- 550bp, WT- 175bp; 2= KO- 750bp, WT- 450bp || 4EBP1/2 || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || GDF15 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
AMPK, fTSC, fRaptor, and C57Bl6/J are all wild-type mice and don&#039;t need to be genotyped.&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1615</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1615"/>
		<updated>2020-06-08T14:59:15Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added relevant strains&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Strain(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || aTSC, mTSC, Placenta TSC || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || aTSC, mTSC, Adipo-Raptor, Adipo-GR-KO, Placenta TSC, Placenta GR || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || GR-KO and Adipo-GR-KO || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || mc4r || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || ppp1r3c (PTG) || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1= KO- 550bp, WT- 175bp; 2= KO- 750bp, WT- 450bp || 4EBP1/2 || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || GDF15 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
AMPK, fTSC, fRaptor, and C57Bl6/J are all wild-type mice and don&#039;t need to be genotyped.&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=GDF15_Genotyping&amp;diff=1614</id>
		<title>GDF15 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=GDF15_Genotyping&amp;diff=1614"/>
		<updated>2020-06-08T14:51:23Z</updated>

		<summary type="html">&lt;p&gt;Reddj: created page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*Fwd1: 5&#039; GAT TCC CGC CCG AAT TAG C 3&#039;&lt;br /&gt;
*Fwd2: 5&#039; CCG AAT TAG CCT GGT CAC CC 3&#039;&lt;br /&gt;
*Rev: 5’ ATC CGT CCT ACT CTG GCT AAG 3&#039;&lt;br /&gt;
&lt;br /&gt;
Make primers at 0.4uM (Fwd1 + Rev and Fwd2 + Rev). PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
|1. Initiation/Melting || 95 || 3:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|2. Denaturation || 95 || 0:30 || 38 ||&lt;br /&gt;
|-&lt;br /&gt;
|3. Annealing || 60 || 0:40 || 38 ||&lt;br /&gt;
|-&lt;br /&gt;
|4. Elongation || 72 || 1:00 || 38 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
|5. Amplification || 72 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1613</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1613"/>
		<updated>2020-06-08T14:47:21Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1= KO- 550bp, WT- 175bp; 2= KO- 750bp, WT- 450bp || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1612</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1612"/>
		<updated>2020-06-08T14:46:46Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added gdf15&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1=KO- 550bp, WT- 175bp; 2=KO- 750bp, WT- 450bp || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[GDF15 Genotyping| GDF15]] || GDF15 || KO- 200bp, WT- 600bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1611</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1611"/>
		<updated>2020-06-08T14:41:19Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added band size&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&#039;&#039;&#039;4EBP1&#039;&#039;&#039;&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
WT= 175bp  KO= 550bp&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;4EBP2&#039;&#039;&#039;&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
WT= 450bp  KO= 750bp&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1610</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1610"/>
		<updated>2020-06-08T14:39:33Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&#039;&#039;&#039;4EBP1&#039;&#039;&#039;&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;4EBP2&#039;&#039;&#039;&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1609</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1609"/>
		<updated>2020-06-08T14:38:05Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
#&#039;4EBP1&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
#4EBP2&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1608</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1608"/>
		<updated>2020-06-08T14:35:58Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;&#039;4EBP1&amp;quot;&#039;&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;&#039;4EBP2&amp;quot;&#039;&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1607</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1607"/>
		<updated>2020-06-08T14:35:39Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
&amp;quot;4EBP1&amp;quot;&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;4EBP2&amp;quot;&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1606</id>
		<title>4EBP1/2 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=4EBP1/2_Genotyping&amp;diff=1606"/>
		<updated>2020-06-08T14:35:00Z</updated>

		<summary type="html">&lt;p&gt;Reddj: created page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*4EBP1- Fwd: GAT GGA GTG TCG GAA CTC ACC (1X)&lt;br /&gt;
*4EBP1- Rev: GAC CTG GAC AGG ACT CAC CGC (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
*4EBP2-Fwd: GGT GGG ACT GTC GGT CTT CTG (1X)&lt;br /&gt;
*4EBP2-Rev: CAG CAC CTG GTC ATA GCC GTG (2X)&lt;br /&gt;
*4EBP1/2- Neo Fwd: GCA TCG AGC GAG CAC GTA CTC (1X)&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd1 + Rev1, Neo Fwd1/2 + Rev1, Fwd2 + Rev2, and Neo Fwd1/2 + Rev2). PCR 4EBP1 and 4EBP2 primers separately.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1605</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1605"/>
		<updated>2020-06-08T14:10:04Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added 4ebp1/2&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540bp, WT- 400bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574bp, WT- 678bp || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[4EBP1/2 Genotyping| 4EBP1/2]] || [[Cre PCR]] || 1=KO- 550bp, WT- 175bp; 2=KO- 750bp, WT- 450bp || Two bands if heterozygote for each allele (run primers for 1 and 2 separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&amp;diff=1604</id>
		<title>Ppp1r3c Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Ppp1r3c_Genotyping&amp;diff=1604"/>
		<updated>2020-06-05T18:17:54Z</updated>

		<summary type="html">&lt;p&gt;Reddj: created page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
*Fwd: TGCTCTCCTTTTCTCCACGT&lt;br /&gt;
*Rev: CCGGACCTGAACCTTCTTCT&lt;br /&gt;
*Neo Rev: GCAGCGCATCGCCTTCTATC&lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev}. PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
|1. Initiation/Melting || 95 || 3:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|2. Denaturation || 95 || 0:30 || 35 ||&lt;br /&gt;
|-&lt;br /&gt;
|3. Annealing || 60 || 1:00 || 35 ||&lt;br /&gt;
|-&lt;br /&gt;
|4. Elongation || 72 || 1:00 || 35 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
|5. Amplification || 72 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1603</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1603"/>
		<updated>2020-06-05T17:57:21Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added PTG&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540, WT- 400 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|-&lt;br /&gt;
|[[ppp1r3c Genotyping| PTG]] || ppp1r3c (PTG) || KO- 574, WT- 678 || Two bands if heterozygote (run primers separately)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1602</id>
		<title>Mc4r-Cone Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1602"/>
		<updated>2020-06-05T17:54:00Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added original google doc&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*Fwd: CAC TCG GAG CTT CCC TGA CCC AG&lt;br /&gt;
*Rev: GAC CAT GGT TTC CGA CCC ATT&lt;br /&gt;
*Neo Rev: TTC CAA GCC TCT GAG CCC AGA &lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev). PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
|1. Initiation/Melting || 94 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|2. Denaturation || 94 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
|3. Annealing || 66 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
|4. Elongation || 72 || 0:45 || 40 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
|5. Amplification || 72 || 7:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
More information here [https://drive.google.com/file/d/0B1nvEJ5tMFVtdnJrSG91aFNhbHRjaUh0RGxLa1lUZ2tXWDhn/view mc4r-Cone]&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1601</id>
		<title>Mc4r-Cone Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1601"/>
		<updated>2020-06-05T17:49:50Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*Fwd: CAC TCG GAG CTT CCC TGA CCC AG&lt;br /&gt;
*Rev: GAC CAT GGT TTC CGA CCC ATT&lt;br /&gt;
*Neo Rev: TTC CAA GCC TCT GAG CCC AGA &lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev). PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
|1. Initiation/Melting || 94 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|2. Denaturation || 94 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
|3. Annealing || 66 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
|4. Elongation || 72 || 0:45 || 40 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
|5. Amplification || 72 || 7:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
|6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1600</id>
		<title>Mc4r-Cone Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Mc4r-Cone_Genotyping&amp;diff=1600"/>
		<updated>2020-06-05T17:48:54Z</updated>

		<summary type="html">&lt;p&gt;Reddj: create page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*Fwd: CAC TCG GAG CTT CCC TGA CCC AG&lt;br /&gt;
*Rev: GAC CAT GGT TTC CGA CCC ATT&lt;br /&gt;
*Neo Rev: TTC CAA GCC TCT GAG CCC AGA &lt;br /&gt;
&lt;br /&gt;
Make primers at 1uM (Fwd + Rev and Fwd + Neo Rev). PCR primers separately.&lt;br /&gt;
&lt;br /&gt;
==PCR PROTOCOL==&lt;br /&gt;
{|border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| PCR Step || Temperature || Time || Cycles || Notes&lt;br /&gt;
|-&lt;br /&gt;
1. Initiation/Melting || 94 || 5:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
2. Denaturation || 94 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
3. Annealing || 66 || 0:45 || 40 ||&lt;br /&gt;
|-&lt;br /&gt;
4. Elongation || 72 || 0:45 || 40 || steps 2-4 to be run in sequence&lt;br /&gt;
|-&lt;br /&gt;
5. Amplification || 72 || 7:00 || 1 ||&lt;br /&gt;
|-&lt;br /&gt;
6. Finish || 4 || infinite || n/a ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1599</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1599"/>
		<updated>2020-06-05T17:41:47Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540, WT- 400 || Two bands if heterozygote (run primers separately&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1598</id>
		<title>Genotyping Program</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Genotyping_Program&amp;diff=1598"/>
		<updated>2020-06-05T15:21:38Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added mc4r-Cone&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{| border=&amp;quot;1&amp;quot;&lt;br /&gt;
!| Allele || Program|| Fragment Size(s) || Notes&lt;br /&gt;
|- &lt;br /&gt;
|[[TSC-floxed Genotyping| TSC-floxed]]|| [[Cre PCR]] || KO- 368bp, WT- 295bp || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[Cre Genotyping|Cre]] || [[Cre PCR ]] || || Only present if Transgene Positive (cannot detect homozygosity at transgene)&lt;br /&gt;
|-&lt;br /&gt;
|[[Vac14 Genotyping|Vac14]] || [[Cre PCR]]||  || Two bands if heterozygote&lt;br /&gt;
|- &lt;br /&gt;
|[[TC10b Genotyping|TC10b]] || TC10b || KO - 500bp, WT-1kb || Two bands if heterozygote&lt;br /&gt;
|&lt;br /&gt;
|[[Ob/ob_Genotyping|ob/ob Genotyping]] || ob/ob|| KO - 123bp, WT-104kb, control 191 bp || Two reactions, see [[Ob/ob_Genotyping|ob/ob Genotyping]]&lt;br /&gt;
|- &lt;br /&gt;
|[[MTM1 Genotyping|MTM1]] || MTM1 || Mutant-575bp, WT-714bp  || Separate Reactions for WT and KO&lt;br /&gt;
|-&lt;br /&gt;
|[[CAP Genotyping|CAP]] || CAP ||  || Two bands if heterozygote, upper band for KO&lt;br /&gt;
|-&lt;br /&gt;
|[[Vinexin Genotyping|Vinexin]] || Vinexin || ||&lt;br /&gt;
|-&lt;br /&gt;
|[[nr3c1 Genotyping| GR KO]] || nr3c1 || KO- 300bp, WT- 247bp || Two bands if heterozygote&lt;br /&gt;
|-&lt;br /&gt;
|[[mc4r-Cone Genotyping| mc4r-Cone]] || mc4r || KO- 540, WT- 400 || Two bands if heterozygote (run primers separately&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Cre_Genotyping&amp;diff=1597</id>
		<title>Cre Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Cre_Genotyping&amp;diff=1597"/>
		<updated>2020-06-05T15:14:57Z</updated>

		<summary type="html">&lt;p&gt;Reddj: created page&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
&lt;br /&gt;
*Fwd: GCATT ACCGG GCAAC GAGTG ATGAG&lt;br /&gt;
*Rev: GAGTG AACGA ACCTG GTCGA AATCA GTGCG&lt;br /&gt;
&lt;br /&gt;
Make primer dilution at 0.4uM.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;br /&gt;
[[ Category:mTORC1 ]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1596</id>
		<title>Nr3c1 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1596"/>
		<updated>2020-06-05T15:10:47Z</updated>

		<summary type="html">&lt;p&gt;Reddj: added cre primers&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
nr3c1&lt;br /&gt;
*Fwd: AAACAGGGTTATGCTTGGCA&lt;br /&gt;
*Rev: TGCCTGCTAGGCAAATGATCT&lt;br /&gt;
&lt;br /&gt;
Cre&lt;br /&gt;
*Fwd: GCATT ACCGG GCAAC GAGTG ATGAG&lt;br /&gt;
*Rev: GAGTG AACGA ACCTG GTCGA AATCA GTGCG&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Make nr3c1 primer dilution at 1uM (10uL each primer + 980uL water) and Cre at .4uM. Primers in &#039;&#039;&#039;Genotyping Box&#039;&#039;&#039;  are marked with a star.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
	<entry>
		<id>https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1595</id>
		<title>Nr3c1 Genotyping</title>
		<link rel="alternate" type="text/html" href="https://bridgeslab.sph.umich.edu/protocols/index.php?title=Nr3c1_Genotyping&amp;diff=1595"/>
		<updated>2020-06-05T15:08:21Z</updated>

		<summary type="html">&lt;p&gt;Reddj: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;==PRIMERS==&lt;br /&gt;
*Fwd: AAACAGGGTTATGCTTGGCA&lt;br /&gt;
*Rev: TGCCTGCTAGGCAAATGATCT&lt;br /&gt;
&lt;br /&gt;
Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in &#039;&#039;&#039;Genotyping Box&#039;&#039;&#039;  are marked with a star.&lt;br /&gt;
&lt;br /&gt;
[[ Category:Genotyping ]]&lt;br /&gt;
[[ Category:Mouse Work]]&lt;br /&gt;
[[ Category:PCR]]&lt;br /&gt;
[[ Category:DNA]]&lt;br /&gt;
[[ Category:Molecular Biology]]&lt;/div&gt;</summary>
		<author><name>Reddj</name></author>
	</entry>
</feed>