915
edits
Changes
updated with some clarifications
see [[ SOP - Chloroform ]] for safety information about working with Chloroform.
This is adapted from [http://dx.doi.org /10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]
==Materials==
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Isopropanol
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM* dNTP Mixture (10 mM of each). Note this is not the normal 1 mM dNTP stock in the lab.
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.
==Protocol==
* Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
* Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
* Reedissolved Redissolved in 25 6 μL of water
===Reverse Transcriptase===
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Add to a PCR an eppendorf tube (this is per reaction):** 1 uL of miRNA Oligo dT Adapter Primer
** 1uL of dNTP
** 6uL of tailed RNA
** 5 uL Sterile water
* Heat at 65C for 5 minutesin the heating block.* Briefly centrifugre centrifuge then transfer to a PCR tube and add (per reaction):
** 4 uL 5X First Strand Buffer
** 1 uL 0.1M DTT
** 1 uL RNAseOUT
** 1 uL of Superscript III RT
* Mix gently by pipetting and place in the PCR machine for the following program(called '''SS III Reaction'''):
** Incubate at 50C for 60 min
** Inactivate by heating at 70C for 15 min
* Can store the tailed cDNA at -20 until qPCR
===qPCR===
* Try 50ng Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture). * The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification